Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000459276:

Variant ID: vg1000459276 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 459276
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGTGATACTCTTAGACCGGATGAGTTAGGTATTGTGGTACGTTGGAACGAGGCTCTATGTAATACGATATCAAGCAGACGAAAGACAAGGATTATACT[A/G]
GTTCAGGCCCCTTATCAGGTAATAGCCCTATTTCAGTTTATATGTAATTGATTATGGAAAACCACAGAATACGATGGAAGTAGACGAATTCGATGATACC

Reverse complement sequence

GGTATCATCGAATTCGTCTACTTCCATCGTATTCTGTGGTTTTCCATAATCAATTACATATAAACTGAAATAGGGCTATTACCTGATAAGGGGCCTGAAC[T/C]
AGTATAATCCTTGTCTTTCGTCTGCTTGATATCGTATTACATAGAGCCTCGTTCCAACGTACCACAATACCTAACTCATCCGGTCTAAGAGTATCACTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	15.50%	0.40%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.04%	0.00%	NA
All Japonica	1512	52.80%	46.00%	1.19%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	21.60%	76.70%	1.69%	0.00%	NA
Tropical Japonica	504	94.20%	5.80%	0.00%	0.00%	NA
Japonica Intermediate	241	65.10%	32.80%	2.07%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000459276	A -> G	LOC_Os10g01710.1	upstream_gene_variant ; 1992.0bp to feature; MODIFIER	silent_mutation	Average:55.22; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg1000459276	A -> G	LOC_Os10g01690.1	downstream_gene_variant ; 1985.0bp to feature; MODIFIER	silent_mutation	Average:55.22; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg1000459276	A -> G	LOC_Os10g01700.1	intron_variant ; MODIFIER	silent_mutation	Average:55.22; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000459276	2.26E-22	6.52E-44	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	2.34E-09	3.62E-14	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	1.13E-26	5.44E-66	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	1.91E-10	5.45E-18	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	3.16E-07	3.09E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	1.76E-32	9.00E-78	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	1.64E-10	1.70E-19	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	1.37E-16	1.14E-22	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	1.17E-09	3.61E-12	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	NA	4.72E-07	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	5.71E-45	5.05E-80	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	3.60E-20	2.76E-32	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	1.02E-24	1.74E-35	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000459276	5.21E-14	4.43E-22	mr1959_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251