| Variant ID: vg1000453123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 453123 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATCACTAGAAATAATGGCTGCGTTGTAACGGGTAAATATTATTTTAATCTTATTATTGTTATACAGTTTAATTAAGGTGAAATTCAATATGAGAATTCG[C/T,A]
TTGGATATATATATATATTTTTTGAAAATCATGAACTGCAATTAGAATTTCGATCATCTCAAGTTAGCATGCAAAATTTTTTAAAGAGATTTCTTATATG
CATATAAGAAATCTCTTTAAAAAATTTTGCATGCTAACTTGAGATGATCGAAATTCTAATTGCAGTTCATGATTTTCAAAAAATATATATATATATCCAA[G/A,T]
CGAATTCTCATATTGAATTTCACCTTAATTAAACTGTATAACAATAATAAGATTAAAATAATATTTACCCGTTACAACGCAGCCATTATTTCTAGTGATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.90% | 26.70% | 1.82% | 0.49% | A: 0.04% |
| All Indica | 2759 | 95.30% | 3.60% | 0.91% | 0.18% | NA |
| All Japonica | 1512 | 43.80% | 55.80% | 0.33% | 0.07% | NA |
| Aus | 269 | 0.70% | 84.00% | 10.04% | 4.46% | A: 0.74% |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 93.40% | 4.80% | 1.42% | 0.33% | NA |
| Indica Intermediate | 786 | 92.20% | 6.20% | 1.27% | 0.25% | NA |
| Temperate Japonica | 767 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.90% | 55.60% | 2.07% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 65.60% | 26.04% | 5.21% | NA |
| Intermediate | 90 | 60.00% | 35.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000453123 | C -> T | LOC_Os10g01690.1 | upstream_gene_variant ; 2864.0bp to feature; MODIFIER | silent_mutation | Average:40.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1000453123 | C -> T | LOC_Os10g01680.1 | downstream_gene_variant ; 163.0bp to feature; MODIFIER | silent_mutation | Average:40.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1000453123 | C -> T | LOC_Os10g01680-LOC_Os10g01690 | intergenic_region ; MODIFIER | silent_mutation | Average:40.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1000453123 | C -> A | LOC_Os10g01690.1 | upstream_gene_variant ; 2864.0bp to feature; MODIFIER | silent_mutation | Average:40.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1000453123 | C -> A | LOC_Os10g01680.1 | downstream_gene_variant ; 163.0bp to feature; MODIFIER | silent_mutation | Average:40.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1000453123 | C -> A | LOC_Os10g01680-LOC_Os10g01690 | intergenic_region ; MODIFIER | silent_mutation | Average:40.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1000453123 | C -> DEL | N | N | silent_mutation | Average:40.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000453123 | 2.11E-06 | 2.10E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 5.31E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 3.15E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | 3.65E-06 | 7.22E-22 | mr1156 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 4.98E-09 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 4.40E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 6.11E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 1.51E-22 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 6.84E-08 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000453123 | NA | 9.02E-07 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/