\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000446805:

Variant ID: vg1000446805 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 446805
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TCACATCAAAACTTTTCTACACACAAACTTCCAATTTTTCCGTCACATCGCACCAATTTCAACCAAACTTCCAGTTTTAGCGTGAAAAAAACACACCCTA[G/A]
TTCATCTTCGAAATTCTGTAATCAACCAGTCCATCAAGCACTGCTGTACTGCAGTACTGCACTATGTATACACATCCTAATACACGCATGCATAGTCAGC

Reverse complement sequence

GCTGACTATGCATGCGTGTATTAGGATGTGTATACATAGTGCAGTACTGCAGTACAGCAGTGCTTGATGGACTGGTTGATTACAGAATTTCGAAGATGAA[C/T]
TAGGGTGTGTTTTTTTCACGCTAAAACTGGAAGTTTGGTTGAAATTGGTGCGATGTGACGGAAAAATTGGAAGTTTGTGTGTAGAAAAGTTTTGATGTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.10% 16.90% 6.28% 0.72% NA
All Indica  2759 96.10% 0.30% 3.41% 0.18% NA
All Japonica  1512 49.10% 50.30% 0.53% 0.07% NA
Aus  269 33.50% 3.00% 60.97% 2.60% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.40% 0.65% 0.00% NA
Indica III  913 93.90% 0.20% 5.70% 0.22% NA
Indica Intermediate  786 94.30% 0.40% 4.96% 0.38% NA
Temperate Japonica  767 20.10% 79.70% 0.26% 0.00% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 51.90% 45.20% 2.49% 0.41% NA
VI/Aromatic  96 46.90% 9.40% 23.96% 19.79% NA
Intermediate  90 72.20% 16.70% 8.89% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000446805 G -> A LOC_Os10g01670.1 upstream_gene_variant ; 1242.0bp to feature; MODIFIER silent_mutation Average:65.225; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg1000446805 G -> A LOC_Os10g01680.1 upstream_gene_variant ; 1865.0bp to feature; MODIFIER silent_mutation Average:65.225; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg1000446805 G -> A LOC_Os10g01670-LOC_Os10g01680 intergenic_region ; MODIFIER silent_mutation Average:65.225; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N
vg1000446805 G -> DEL N N silent_mutation Average:65.225; most accessible tissue: Zhenshan97 flag leaf, score: 76.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000446805 7.19E-28 2.40E-49 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 3.73E-12 1.28E-16 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 4.67E-33 7.02E-73 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 4.89E-13 1.61E-19 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 2.17E-07 1.25E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 1.15E-43 1.39E-89 mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 1.43E-15 7.77E-24 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 4.10E-16 1.19E-21 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 4.40E-09 2.58E-11 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 1.28E-49 9.20E-84 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 9.88E-23 2.22E-33 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 4.04E-23 1.03E-33 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000446805 8.34E-13 1.33E-19 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251