Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000443503:

Variant ID: vg1000443503 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 443503
Reference Allele: ATCAG	Alternative Allele: A,CTCAG
Primary Allele: CTCAG	Secondary Allele: ATCAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGTGCTTTAGAGATTATCTTGGTGGTATTTTTTAAAAAAAATGAATTTGTCCCAGTTACATATAAATTTCACTATTGTTTTGGGACAAAATTTGACTC[ATCAG/A,CTCAG]
ATTTATGTGACCGAGGGAGTATAAGAAATATAAGTCTTTCTTTAATTAGATAAAGTAGTCTATTTTTAATAAAAATATCTTTCATTAATATATAATAAAT

Reverse complement sequence

ATTTATTATATATTAATGAAAGATATTTTTATTAAAAATAGACTACTTTATCTAATTAAAGAAAGACTTATATTTCTTATACTCCCTCGGTCACATAAAT[CTGAT/T,CTGAG]
GAGTCAAATTTTGTCCCAAAACAATAGTGAAATTTATATGTAACTGGGACAAATTCATTTTTTTTAAAAAATACCACCAAGATAATCTCTAAAGCACCAT

Allele Frequencies:

Populations	Population Size	Frequency of CTCAG(primary allele)	Frequency of ATCAG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	16.30%	4.63%	13.27%	A: 1.10%
All Indica	2759	78.50%	1.00%	6.27%	13.16%	A: 1.09%
All Japonica	1512	44.80%	46.70%	1.39%	6.68%	A: 0.40%
Aus	269	36.40%	4.80%	5.58%	49.81%	A: 3.35%
Indica I	595	98.00%	0.20%	1.18%	0.67%	NA
Indica II	465	95.50%	0.40%	1.72%	1.72%	A: 0.65%
Indica III	913	54.10%	1.80%	12.81%	29.13%	A: 2.19%
Indica Intermediate	786	81.90%	1.10%	5.22%	10.81%	A: 0.89%
Temperate Japonica	767	18.00%	76.30%	0.78%	4.69%	A: 0.26%
Tropical Japonica	504	84.70%	6.00%	1.98%	6.75%	A: 0.60%
Japonica Intermediate	241	46.90%	37.80%	2.07%	12.86%	A: 0.41%
VI/Aromatic	96	56.20%	11.50%	6.25%	20.83%	A: 5.21%
Intermediate	90	67.80%	15.60%	4.44%	10.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000443503	ATCAG -> CTCAG	LOC_Os10g01670.1	downstream_gene_variant ; 1035.0bp to feature; MODIFIER	silent_mutation	Average:25.572; most accessible tissue: Callus, score: 45.597	N	N	N	N
vg1000443503	ATCAG -> CTCAG	LOC_Os10g01660-LOC_Os10g01670	intergenic_region ; MODIFIER	silent_mutation	Average:25.572; most accessible tissue: Callus, score: 45.597	N	N	N	N
vg1000443503	ATCAG -> A	LOC_Os10g01670.1	downstream_gene_variant ; 1034.0bp to feature; MODIFIER	silent_mutation	Average:25.572; most accessible tissue: Callus, score: 45.597	N	N	N	N
vg1000443503	ATCAG -> A	LOC_Os10g01660-LOC_Os10g01670	intergenic_region ; MODIFIER	silent_mutation	Average:25.572; most accessible tissue: Callus, score: 45.597	N	N	N	N
vg1000443503	ATCAG -> DEL	N	N	silent_mutation	Average:25.572; most accessible tissue: Callus, score: 45.597	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000443503	7.86E-06	7.86E-06	mr1260	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	9.05E-29	1.97E-50	mr1300	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	3.29E-12	7.15E-17	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	4.54E-30	1.45E-70	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	1.87E-11	2.31E-18	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	5.56E-07	1.15E-06	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	NA	2.05E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	1.78E-40	3.11E-87	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	1.58E-13	4.19E-22	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	1.46E-16	4.29E-22	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	3.48E-09	1.98E-11	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	1.80E-46	7.21E-82	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	5.92E-20	6.27E-32	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	2.46E-22	1.99E-33	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503	1.76E-11	9.82E-19	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251