\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000443503:

Variant ID: vg1000443503 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 443503
Reference Allele: ATCAGAlternative Allele: A,CTCAG
Primary Allele: CTCAGSecondary Allele: ATCAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGTGCTTTAGAGATTATCTTGGTGGTATTTTTTAAAAAAAATGAATTTGTCCCAGTTACATATAAATTTCACTATTGTTTTGGGACAAAATTTGACTC[ATCAG/A,CTCAG]
ATTTATGTGACCGAGGGAGTATAAGAAATATAAGTCTTTCTTTAATTAGATAAAGTAGTCTATTTTTAATAAAAATATCTTTCATTAATATATAATAAAT

Reverse complement sequence

ATTTATTATATATTAATGAAAGATATTTTTATTAAAAATAGACTACTTTATCTAATTAAAGAAAGACTTATATTTCTTATACTCCCTCGGTCACATAAAT[CTGAT/T,CTGAG]
GAGTCAAATTTTGTCCCAAAACAATAGTGAAATTTATATGTAACTGGGACAAATTCATTTTTTTTAAAAAATACCACCAAGATAATCTCTAAAGCACCAT

Allele Frequencies:

Populations Population SizeFrequency of CTCAG(primary allele) Frequency of ATCAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 16.30% 4.63% 13.27% A: 1.10%
All Indica  2759 78.50% 1.00% 6.27% 13.16% A: 1.09%
All Japonica  1512 44.80% 46.70% 1.39% 6.68% A: 0.40%
Aus  269 36.40% 4.80% 5.58% 49.81% A: 3.35%
Indica I  595 98.00% 0.20% 1.18% 0.67% NA
Indica II  465 95.50% 0.40% 1.72% 1.72% A: 0.65%
Indica III  913 54.10% 1.80% 12.81% 29.13% A: 2.19%
Indica Intermediate  786 81.90% 1.10% 5.22% 10.81% A: 0.89%
Temperate Japonica  767 18.00% 76.30% 0.78% 4.69% A: 0.26%
Tropical Japonica  504 84.70% 6.00% 1.98% 6.75% A: 0.60%
Japonica Intermediate  241 46.90% 37.80% 2.07% 12.86% A: 0.41%
VI/Aromatic  96 56.20% 11.50% 6.25% 20.83% A: 5.21%
Intermediate  90 67.80% 15.60% 4.44% 10.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000443503 ATCAG -> CTCAG LOC_Os10g01670.1 downstream_gene_variant ; 1035.0bp to feature; MODIFIER silent_mutation Average:25.572; most accessible tissue: Callus, score: 45.597 N N N N
vg1000443503 ATCAG -> CTCAG LOC_Os10g01660-LOC_Os10g01670 intergenic_region ; MODIFIER silent_mutation Average:25.572; most accessible tissue: Callus, score: 45.597 N N N N
vg1000443503 ATCAG -> A LOC_Os10g01670.1 downstream_gene_variant ; 1034.0bp to feature; MODIFIER silent_mutation Average:25.572; most accessible tissue: Callus, score: 45.597 N N N N
vg1000443503 ATCAG -> A LOC_Os10g01660-LOC_Os10g01670 intergenic_region ; MODIFIER silent_mutation Average:25.572; most accessible tissue: Callus, score: 45.597 N N N N
vg1000443503 ATCAG -> DEL N N silent_mutation Average:25.572; most accessible tissue: Callus, score: 45.597 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000443503 7.86E-06 7.86E-06 mr1260 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 9.05E-29 1.97E-50 mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 3.29E-12 7.15E-17 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 4.54E-30 1.45E-70 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 1.87E-11 2.31E-18 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 5.56E-07 1.15E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 NA 2.05E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 1.78E-40 3.11E-87 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 1.58E-13 4.19E-22 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 1.46E-16 4.29E-22 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 3.48E-09 1.98E-11 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 1.80E-46 7.21E-82 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 5.92E-20 6.27E-32 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 2.46E-22 1.99E-33 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000443503 1.76E-11 9.82E-19 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251