\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000442554:

Variant ID: vg1000442554 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 442554
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACATCCCAACACATGGAGCCGACATGTTATATATAACTAGAAAAAATATCTGTGCGTTGCAATGGGTGAAGGCTATTTTGATTTTATTATTGTTATAT[A/G]
GTTTAGTTAAGGTGAAAATCATGAACTACGATTAGGAGTATGATCATCTCAAGTTAGCATGCGAGTTTTTTTTTTAAAAAATATTTCTTATATGACTCCT

Reverse complement sequence

AGGAGTCATATAAGAAATATTTTTTAAAAAAAAAACTCGCATGCTAACTTGAGATGATCATACTCCTAATCGTAGTTCATGATTTTCACCTTAACTAAAC[T/C]
ATATAACAATAATAAAATCAAAATAGCCTTCACCCATTGCAACGCACAGATATTTTTTCTAGTTATATATAACATGTCGGCTCCATGTGTTGGGATGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 17.00% 0.53% 5.63% NA
All Indica  2759 96.90% 0.30% 0.11% 2.68% NA
All Japonica  1512 49.00% 50.40% 0.20% 0.40% NA
Aus  269 35.70% 3.30% 0.74% 60.22% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.40% 0.00% 0.65% NA
Indica III  913 96.30% 0.10% 0.33% 3.29% NA
Indica Intermediate  786 94.30% 0.50% 0.00% 5.22% NA
Temperate Japonica  767 19.70% 79.80% 0.13% 0.39% NA
Tropical Japonica  504 92.30% 7.70% 0.00% 0.00% NA
Japonica Intermediate  241 51.90% 46.10% 0.83% 1.24% NA
VI/Aromatic  96 56.20% 9.40% 14.58% 19.79% NA
Intermediate  90 74.40% 16.70% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000442554 A -> G LOC_Os10g01660.1 upstream_gene_variant ; 4507.0bp to feature; MODIFIER silent_mutation Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 N N N N
vg1000442554 A -> G LOC_Os10g01670.1 downstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 N N N N
vg1000442554 A -> G LOC_Os10g01660-LOC_Os10g01670 intergenic_region ; MODIFIER silent_mutation Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 N N N N
vg1000442554 A -> DEL N N silent_mutation Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000442554 6.45E-06 6.45E-06 mr1260 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 2.57E-26 5.68E-48 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 5.06E-12 1.38E-16 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 9.75E-34 1.18E-74 mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 2.20E-12 3.21E-19 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 3.62E-07 2.76E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 4.61E-39 1.58E-85 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 1.92E-14 4.27E-23 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 7.99E-16 1.26E-21 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 4.68E-09 2.48E-11 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 8.30E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 1.71E-49 1.13E-85 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 5.32E-22 1.67E-33 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 1.53E-23 1.64E-34 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000442554 4.69E-13 3.04E-20 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251