| Variant ID: vg1000442554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 442554 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATACATCCCAACACATGGAGCCGACATGTTATATATAACTAGAAAAAATATCTGTGCGTTGCAATGGGTGAAGGCTATTTTGATTTTATTATTGTTATAT[A/G]
GTTTAGTTAAGGTGAAAATCATGAACTACGATTAGGAGTATGATCATCTCAAGTTAGCATGCGAGTTTTTTTTTTAAAAAATATTTCTTATATGACTCCT
AGGAGTCATATAAGAAATATTTTTTAAAAAAAAAACTCGCATGCTAACTTGAGATGATCATACTCCTAATCGTAGTTCATGATTTTCACCTTAACTAAAC[T/C]
ATATAACAATAATAAAATCAAAATAGCCTTCACCCATTGCAACGCACAGATATTTTTTCTAGTTATATATAACATGTCGGCTCCATGTGTTGGGATGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.90% | 17.00% | 0.53% | 5.63% | NA |
| All Indica | 2759 | 96.90% | 0.30% | 0.11% | 2.68% | NA |
| All Japonica | 1512 | 49.00% | 50.40% | 0.20% | 0.40% | NA |
| Aus | 269 | 35.70% | 3.30% | 0.74% | 60.22% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.00% | 0.65% | NA |
| Indica III | 913 | 96.30% | 0.10% | 0.33% | 3.29% | NA |
| Indica Intermediate | 786 | 94.30% | 0.50% | 0.00% | 5.22% | NA |
| Temperate Japonica | 767 | 19.70% | 79.80% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.90% | 46.10% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 56.20% | 9.40% | 14.58% | 19.79% | NA |
| Intermediate | 90 | 74.40% | 16.70% | 3.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000442554 | A -> G | LOC_Os10g01660.1 | upstream_gene_variant ; 4507.0bp to feature; MODIFIER | silent_mutation | Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 | N | N | N | N |
| vg1000442554 | A -> G | LOC_Os10g01670.1 | downstream_gene_variant ; 1984.0bp to feature; MODIFIER | silent_mutation | Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 | N | N | N | N |
| vg1000442554 | A -> G | LOC_Os10g01660-LOC_Os10g01670 | intergenic_region ; MODIFIER | silent_mutation | Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 | N | N | N | N |
| vg1000442554 | A -> DEL | N | N | silent_mutation | Average:25.451; most accessible tissue: Zhenshan97 young leaf, score: 37.835 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000442554 | 6.45E-06 | 6.45E-06 | mr1260 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 2.57E-26 | 5.68E-48 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 5.06E-12 | 1.38E-16 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 9.75E-34 | 1.18E-74 | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 2.20E-12 | 3.21E-19 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 3.62E-07 | 2.76E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 4.61E-39 | 1.58E-85 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 1.92E-14 | 4.27E-23 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 7.99E-16 | 1.26E-21 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000442554 | 4.68E-09 | 2.48E-11 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/