Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000393294:

Variant ID: vg1000393294 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 393294
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GCAATTTTGAAATGTGTGAGTTGAAATATTGCCAACCATTCATAATATTTGAAATTTATGAAGATTTGCAACAAAACTCATTTGAGTGCTAGGAGGTGAC[C/T]
ATTTATGGTCTATAGGGGTTTTTGGGCGAATTTGATTTTCAAACAACTTTTGAAATATTTGGTTTTTGAATATGATTTGAACACCAAAAACATTTCAAAA

Reverse complement sequence

TTTTGAAATGTTTTTGGTGTTCAAATCATATTCAAAAACCAAATATTTCAAAAGTTGTTTGAAAATCAAATTCGCCCAAAAACCCCTATAGACCATAAAT[G/A]
GTCACCTCCTAGCACTCAAATGAGTTTTGTTGCAAATCTTCATAAATTTCAAATATTATGAATGGTTGGCAATATTTCAACTCACACATTTCAAAATTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	8.50%	29.24%	6.18%	NA
All Indica	2759	48.20%	8.40%	33.27%	10.15%	NA
All Japonica	1512	61.40%	10.60%	27.71%	0.20%	NA
Aus	269	89.20%	0.00%	8.18%	2.60%	NA
Indica I	595	33.90%	7.20%	37.65%	21.18%	NA
Indica II	465	56.80%	7.30%	33.12%	2.80%	NA
Indica III	913	46.90%	11.10%	36.25%	5.81%	NA
Indica Intermediate	786	55.30%	6.90%	26.59%	11.20%	NA
Temperate Japonica	767	90.60%	0.80%	8.47%	0.13%	NA
Tropical Japonica	504	16.70%	26.60%	56.35%	0.40%	NA
Japonica Intermediate	241	62.20%	8.70%	29.05%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	64.40%	7.80%	25.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000393294	C -> T	LOC_Os10g01590.1	upstream_gene_variant ; 1108.0bp to feature; MODIFIER	silent_mutation	Average:14.838; most accessible tissue: Callus, score: 29.902	N	N	N	N
vg1000393294	C -> T	LOC_Os10g01600.1	downstream_gene_variant ; 533.0bp to feature; MODIFIER	silent_mutation	Average:14.838; most accessible tissue: Callus, score: 29.902	N	N	N	N
vg1000393294	C -> T	LOC_Os10g01590-LOC_Os10g01600	intergenic_region ; MODIFIER	silent_mutation	Average:14.838; most accessible tissue: Callus, score: 29.902	N	N	N	N
vg1000393294	C -> DEL	N	N	silent_mutation	Average:14.838; most accessible tissue: Callus, score: 29.902	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000393294	3.51E-06	3.51E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	1.75E-09	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	2.86E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	9.15E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	6.84E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	3.66E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	4.99E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	7.03E-06	mr1482	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	2.53E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	1.23E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	1.49E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	1.92E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	5.88E-08	mr1565	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	5.49E-11	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	2.35E-09	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	3.58E-08	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	7.71E-09	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	4.83E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	2.04E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	4.58E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	2.26E-08	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	1.10E-10	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000393294	NA	1.86E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251