Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000389182:

Variant ID: vg1000389182 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 389182
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ATCACTAGGGTAGTTCTTCCTTCACTCCGAAGATAGTGAACTCCAAACCACTCACAAACCGGCACCGGGCCTCCTCCACAATCTTCTCGGAGAGGTCACC[G/A]
GGCAACTTCTCCACAAGCCGACTAGGAGGCGGCAACCTCCAAGAGTAACAAGTAATGACCCGGCGTGGAGATGATCAAGTGCCACACTAGCTCTACAATG

Reverse complement sequence

CATTGTAGAGCTAGTGTGGCACTTGATCATCTCCACGCCGGGTCATTACTTGTTACTCTTGGAGGTTGCCGCCTCCTAGTCGGCTTGTGGAGAAGTTGCC[C/T]
GGTGACCTCTCCGAGAAGATTGTGGAGGAGGCCCGGTGCCGGTTTGTGAGTGGTTTGGAGTTCACTATCTTCGGAGTGAAGGAAGAACTACCCTAGTGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.00%	3.00%	0.00%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	92.10%	7.90%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	85.30%	14.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000389182	G -> A	LOC_Os10g01580.1	downstream_gene_variant ; 2160.0bp to feature; MODIFIER	silent_mutation	Average:51.792; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1000389182	G -> A	LOC_Os10g01590.1	downstream_gene_variant ; 1577.0bp to feature; MODIFIER	silent_mutation	Average:51.792; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1000389182	G -> A	LOC_Os10g01600.1	downstream_gene_variant ; 4645.0bp to feature; MODIFIER	silent_mutation	Average:51.792; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1000389182	G -> A	LOC_Os10g01580-LOC_Os10g01590	intergenic_region ; MODIFIER	silent_mutation	Average:51.792; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000389182	7.45E-06	2.36E-23	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000389182	NA	4.27E-12	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000389182	NA	3.96E-08	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	5.69E-06	3.53E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	4.51E-07	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	3.71E-09	5.74E-14	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	6.12E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	6.02E-06	NA	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	8.26E-06	mr1038_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	9.10E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	7.03E-08	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	9.44E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	8.61E-08	5.33E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	2.36E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	1.81E-09	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	4.29E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	4.23E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	9.94E-06	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	5.24E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	1.54E-09	2.19E-17	mr1829_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	6.95E-07	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	1.64E-10	1.26E-21	mr1902_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000389182	NA	8.36E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251