\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000386935:

Variant ID: vg1000386935 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 386935
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGGCCTCGTCGTCGGTGGCGGCTCCGGGCAAGCATAGCTCCCCCACGCCAGTCACAGCTCCCCCTGCCGCCACCTTGCTCCCCTGCTCCCGCGTCGCC[G/A]
CTGTGTCACCGGCTGCGGACCTCCTCTCCCGCCTCGCCCCGTCTACCGACGGCGGTGGCCTGCCCAAAGCCCCAGAGAGAAGATTGAGAGAAAGAGAAAG

Reverse complement sequence

CTTTCTCTTTCTCTCAATCTTCTCTCTGGGGCTTTGGGCAGGCCACCGCCGTCGGTAGACGGGGCGAGGCGGGAGAGGAGGTCCGCAGCCGGTGACACAG[C/T]
GGCGACGCGGGAGCAGGGGAGCAAGGTGGCGGCAGGGGGAGCTGTGACTGGCGTGGGGGAGCTATGCTTGCCCGGAGCCGCCACCGACGACGAGGCCGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 5.00% 1.74% 2.52% NA
All Indica  2759 94.00% 1.20% 1.27% 3.59% NA
All Japonica  1512 87.90% 8.10% 2.84% 1.19% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 97.10% 0.00% 1.51% 1.34% NA
Indica II  465 94.80% 0.20% 0.86% 4.09% NA
Indica III  913 90.80% 3.10% 1.75% 4.38% NA
Indica Intermediate  786 94.80% 0.40% 0.76% 4.07% NA
Temperate Japonica  767 83.80% 14.50% 1.04% 0.65% NA
Tropical Japonica  504 91.90% 0.60% 4.96% 2.58% NA
Japonica Intermediate  241 92.50% 3.30% 4.15% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 83.30% 10.00% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000386935 G -> A LOC_Os10g01580.1 synonymous_variant ; p.Pro224Pro; LOW synonymous_codon Average:91.882; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N
vg1000386935 G -> DEL LOC_Os10g01580.1 N frameshift_variant Average:91.882; most accessible tissue: Minghui63 young leaf, score: 96.22 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1000386935 G A 0.04 0.01 0.02 0.04 0.05 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000386935 2.56E-09 1.64E-35 Awn_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000386935 NA 1.05E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000386935 7.96E-06 1.15E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 1.61E-06 1.61E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 6.45E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 1.12E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 6.47E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 1.22E-06 1.21E-12 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 7.82E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 9.73E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 1.91E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 2.37E-06 1.62E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 4.35E-09 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 8.18E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 1.25E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 6.92E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 1.51E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 2.81E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 2.43E-06 4.29E-15 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 1.92E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 9.11E-06 6.74E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000386935 NA 1.70E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251