\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000374745:

Variant ID: vg1000374745 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 374745
Reference Allele: TGCAlternative Allele: CGC,T
Primary Allele: CGCSecondary Allele: TGC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTGTAATGGTATATTGACATCATGAGAAAAACTCACCTAGCATATGTTTAGCTAAGTTGATGCACTAAATACTAAATTGTCAAGTTCTTATACTAGAG[TGC/CGC,T]
ACTCACTTATCAAATTATTGCACTCGAACGTTTTAATTCTTAAGTTCTTGCACTATATCATACACACCCGCCAAGTTGTTGTACCGTGAGTGTAATATAT

Reverse complement sequence

ATATATTACACTCACGGTACAACAACTTGGCGGGTGTGTATGATATAGTGCAAGAACTTAAGAATTAAAACGTTCGAGTGCAATAATTTGATAAGTGAGT[GCA/GCG,A]
CTCTAGTATAAGAACTTGACAATTTAGTATTTAGTGCATCAACTTAGCTAAACATATGCTAGGTGAGTTTTTCTCATGATGTCAATATACCATTACAATA

Allele Frequencies:

Populations Population SizeFrequency of CGC(primary allele) Frequency of TGC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 15.40% 0.00% 0.00% T: 0.04%
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 53.30% 46.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 28.20% 71.80% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 8.30% 0.00% 0.00% NA
Japonica Intermediate  241 53.10% 46.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 0.00% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000374745 TGC -> CGC LOC_Os10g01570.1 downstream_gene_variant ; 2402.0bp to feature; MODIFIER silent_mutation Average:40.083; most accessible tissue: Callus, score: 66.226 N N N N
vg1000374745 TGC -> CGC LOC_Os10g01560.1 intron_variant ; MODIFIER silent_mutation Average:40.083; most accessible tissue: Callus, score: 66.226 N N N N
vg1000374745 TGC -> T LOC_Os10g01570.1 downstream_gene_variant ; 2401.0bp to feature; MODIFIER silent_mutation Average:40.083; most accessible tissue: Callus, score: 66.226 N N N N
vg1000374745 TGC -> T LOC_Os10g01560.1 intron_variant ; MODIFIER silent_mutation Average:40.083; most accessible tissue: Callus, score: 66.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000374745 5.65E-11 1.91E-28 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 NA 4.24E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 9.95E-13 1.14E-43 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 4.38E-06 1.04E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 NA 7.58E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 NA 7.21E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 1.95E-06 1.95E-06 mr1644 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 NA 4.29E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 4.65E-06 NA mr1854 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 1.55E-17 1.49E-53 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 3.03E-07 5.08E-12 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 NA 8.47E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 1.24E-14 4.26E-45 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 4.44E-06 2.38E-11 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 4.85E-09 2.56E-21 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000374745 NA 5.70E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251