\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000371326:

Variant ID: vg1000371326 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 371326
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGTGGGACACTTACTAGTACTATAAATCTAGATAACTCTGTTCAGATTTGTTATACTAGAAAATATTCTATCCGTTCAAAATCCGTTATATTTTGGGA[C/G]
AGAGGGAGTAGGATTTATATATAGGTATGTATATGTGTTAATGAAGAATATGGTATACACAAGCAGTTAAATCCAAACGACTATATATAATACACATATA

Reverse complement sequence

TATATGTGTATTATATATAGTCGTTTGGATTTAACTGCTTGTGTATACCATATTCTTCATTAACACATATACATACCTATATATAAATCCTACTCCCTCT[G/C]
TCCCAAAATATAACGGATTTTGAACGGATAGAATATTTTCTAGTATAACAAATCTGAACAGAGTTATCTAGATTTATAGTACTAGTAAGTGTCCCACAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 2.20% 0.02% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.00% 5.90% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 88.90% 11.00% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000371326 C -> G LOC_Os10g01550.1 upstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:40.962; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg1000371326 C -> G LOC_Os10g01550.2 upstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:40.962; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg1000371326 C -> G LOC_Os10g01560.1 downstream_gene_variant ; 900.0bp to feature; MODIFIER silent_mutation Average:40.962; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg1000371326 C -> G LOC_Os10g01550-LOC_Os10g01560 intergenic_region ; MODIFIER silent_mutation Average:40.962; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000371326 NA 1.76E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000371326 5.53E-07 3.88E-10 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 3.14E-06 3.14E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 NA 9.75E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 2.88E-10 1.81E-17 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 NA 1.84E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 8.73E-09 2.92E-18 mr1842 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 NA 2.60E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 NA 2.62E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 NA 6.86E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 NA 7.50E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 5.83E-08 1.89E-18 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 NA 1.17E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000371326 7.39E-06 3.09E-19 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251