\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000348900:

Variant ID: vg1000348900 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 348900
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATCTCTTCTCTTATTTGGTGTGTTCAACTTGTCTTAAACTACACTCTCTTCTGGAGTGGATCTTTGTAATAATTGGCTGTAGTTCTTTTTGAACAAA[A/G]
ACCGGAATATTATATTCCATTATCTAAAAAAAACCAGCTATAAACCCTCAAGCCTTTGGTTGCAAAATAAAAACAAGAAATGCCAACCCAACCCTACAAA

Reverse complement sequence

TTTGTAGGGTTGGGTTGGCATTTCTTGTTTTTATTTTGCAACCAAAGGCTTGAGGGTTTATAGCTGGTTTTTTTTAGATAATGGAATATAATATTCCGGT[T/C]
TTTGTTCAAAAAGAACTACAGCCAATTATTACAAAGATCCACTCCAGAAGAGAGTGTAGTTTAAGACAAGTTGAACACACCAAATAAGAGAAGAGATAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 19.00% 1.50% 1.44% NA
All Indica  2759 95.70% 0.70% 1.81% 1.74% NA
All Japonica  1512 42.10% 55.40% 1.26% 1.26% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 95.00% 0.50% 3.87% 0.67% NA
Indica II  465 94.60% 0.60% 1.51% 3.23% NA
Indica III  913 96.40% 0.80% 1.10% 1.75% NA
Indica Intermediate  786 96.20% 0.90% 1.27% 1.65% NA
Temperate Japonica  767 12.10% 87.40% 0.52% 0.00% NA
Tropical Japonica  504 84.50% 10.10% 1.59% 3.77% NA
Japonica Intermediate  241 49.00% 48.10% 2.90% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 77.80% 18.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000348900 A -> G LOC_Os10g01540.1 3_prime_UTR_variant ; 173.0bp to feature; MODIFIER silent_mutation Average:57.616; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1000348900 A -> G LOC_Os10g01540.2 3_prime_UTR_variant ; 724.0bp to feature; MODIFIER silent_mutation Average:57.616; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1000348900 A -> G LOC_Os10g01530.1 downstream_gene_variant ; 1106.0bp to feature; MODIFIER silent_mutation Average:57.616; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N
vg1000348900 A -> DEL N N silent_mutation Average:57.616; most accessible tissue: Zhenshan97 flower, score: 74.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000348900 1.51E-08 1.51E-08 mr1011 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 1.78E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 6.32E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 1.13E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 6.31E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 9.45E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 3.02E-14 1.60E-35 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 2.34E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 9.32E-15 3.68E-54 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 6.61E-11 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 6.89E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 8.27E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 9.84E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 2.59E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 6.54E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 7.20E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 2.74E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 3.73E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 2.47E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 9.67E-06 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 1.91E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 3.96E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 6.84E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 7.32E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 1.78E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 6.95E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 7.88E-10 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 1.75E-18 4.93E-63 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 9.52E-06 1.89E-12 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 1.16E-09 3.28E-15 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 4.31E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 8.33E-16 4.58E-50 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 1.58E-06 5.76E-14 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 8.05E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 2.83E-10 1.90E-21 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000348900 NA 1.08E-09 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251