Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000344144:

Variant ID: vg1000344144 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 344144
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTCTTATTCAAAAATTTTGTGCAAATGTATAAGATATAAATCACACTTAAAGTACTATGAGTGATAAAACAACTCATAACAAAATAAATTATAATTAC[G/A]
TAAATTTTTTGAATAAGACAAATGGTCAAACATGTGAGAAAAAGTCAATGGCGTCATCTATTGAAAAATGGAGGGAGTACATGAGATAGGGGTTGATCTC

Reverse complement sequence

GAGATCAACCCCTATCTCATGTACTCCCTCCATTTTTCAATAGATGACGCCATTGACTTTTTCTCACATGTTTGACCATTTGTCTTATTCAAAAAATTTA[C/T]
GTAATTATAATTTATTTTGTTATGAGTTGTTTTATCACTCATAGTACTTTAAGTGTGATTTATATCTTATACATTTGCACAAAATTTTTGAATAAGACGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.20%	0.25%	0.00%	NA
All Indica	2759	56.40%	43.20%	0.36%	0.00%	NA
All Japonica	1512	58.50%	41.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	59.20%	40.00%	0.84%	0.00%	NA
Indica II	465	55.30%	44.70%	0.00%	0.00%	NA
Indica III	913	47.50%	52.20%	0.22%	0.00%	NA
Indica Intermediate	786	65.30%	34.40%	0.38%	0.00%	NA
Temperate Japonica	767	88.00%	12.00%	0.00%	0.00%	NA
Tropical Japonica	504	12.50%	87.50%	0.00%	0.00%	NA
Japonica Intermediate	241	60.60%	39.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	62.20%	35.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000344144	G -> A	LOC_Os10g01530.1	upstream_gene_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:35.714; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg1000344144	G -> A	LOC_Os10g01540.1	downstream_gene_variant ; 4654.0bp to feature; MODIFIER	silent_mutation	Average:35.714; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg1000344144	G -> A	LOC_Os10g01540.2	downstream_gene_variant ; 4654.0bp to feature; MODIFIER	silent_mutation	Average:35.714; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg1000344144	G -> A	LOC_Os10g01520-LOC_Os10g01530	intergenic_region ; MODIFIER	silent_mutation	Average:35.714; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000344144	NA	5.91E-06	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	3.28E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	1.19E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	1.20E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	1.98E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	2.84E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	1.05E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	1.69E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	1.92E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	2.93E-06	2.93E-06	mr1621	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	2.37E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	8.79E-08	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	2.20E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	6.06E-07	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	6.27E-08	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	2.04E-10	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000344144	NA	9.46E-08	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251