Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000261110:

Variant ID: vg1000261110 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 261110
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAATGTGCGCCATTAATAAATATATCATCTCTCTTCTCTACCAATCATATTTATTCTTCATCTATTATGAAGACATTATTTTCTCCCAATGCAAAACTT[A/G]
ATAGTGTCTAGTGCATAGGTTCTCGTGTTGAAGCTGTGTCTTGCATGAGACCTAGTTTTTTCCTCTCTTCACTCTTCTCTCTCTTAATTAATATAGTACC

Reverse complement sequence

GGTACTATATTAATTAAGAGAGAGAAGAGTGAAGAGAGGAAAAAACTAGGTCTCATGCAAGACACAGCTTCAACACGAGAACCTATGCACTAGACACTAT[T/C]
AAGTTTTGCATTGGGAGAAAATAATGTCTTCATAATAGATGAAGAATAAATATGATTGGTAGAGAAGAGAGATGATATATTTATTAATGGCGCACATTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	18.70%	0.25%	16.84%	NA
All Indica	2759	98.00%	0.60%	0.07%	1.38%	NA
All Japonica	1512	8.10%	54.70%	0.26%	36.97%	NA
Aus	269	49.80%	3.70%	1.49%	44.98%	NA
Indica I	595	99.00%	0.50%	0.34%	0.17%	NA
Indica II	465	97.20%	0.60%	0.00%	2.15%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	95.50%	1.10%	0.00%	3.31%	NA
Temperate Japonica	767	2.30%	87.00%	0.13%	10.56%	NA
Tropical Japonica	504	16.10%	8.50%	0.60%	74.80%	NA
Japonica Intermediate	241	9.50%	48.50%	0.00%	41.91%	NA
VI/Aromatic	96	28.10%	11.50%	0.00%	60.42%	NA
Intermediate	90	52.20%	23.30%	2.22%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000261110	A -> G	LOC_Os10g01440.1	upstream_gene_variant ; 3970.0bp to feature; MODIFIER	silent_mutation	Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N
vg1000261110	A -> G	LOC_Os10g01430.1	downstream_gene_variant ; 628.0bp to feature; MODIFIER	silent_mutation	Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N
vg1000261110	A -> G	LOC_Os10g01430-LOC_Os10g01440	intergenic_region ; MODIFIER	silent_mutation	Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N
vg1000261110	A -> DEL	N	N	silent_mutation	Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000261110	9.31E-06	9.30E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	2.22E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	3.92E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	5.28E-08	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	2.71E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	2.84E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	3.93E-08	mr1715	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	1.21E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	1.34E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	1.76E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110	NA	2.00E-06	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251