| Variant ID: vg1000261110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 261110 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAATGTGCGCCATTAATAAATATATCATCTCTCTTCTCTACCAATCATATTTATTCTTCATCTATTATGAAGACATTATTTTCTCCCAATGCAAAACTT[A/G]
ATAGTGTCTAGTGCATAGGTTCTCGTGTTGAAGCTGTGTCTTGCATGAGACCTAGTTTTTTCCTCTCTTCACTCTTCTCTCTCTTAATTAATATAGTACC
GGTACTATATTAATTAAGAGAGAGAAGAGTGAAGAGAGGAAAAAACTAGGTCTCATGCAAGACACAGCTTCAACACGAGAACCTATGCACTAGACACTAT[T/C]
AAGTTTTGCATTGGGAGAAAATAATGTCTTCATAATAGATGAAGAATAAATATGATTGGTAGAGAAGAGAGATGATATATTTATTAATGGCGCACATTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 18.70% | 0.25% | 16.84% | NA |
| All Indica | 2759 | 98.00% | 0.60% | 0.07% | 1.38% | NA |
| All Japonica | 1512 | 8.10% | 54.70% | 0.26% | 36.97% | NA |
| Aus | 269 | 49.80% | 3.70% | 1.49% | 44.98% | NA |
| Indica I | 595 | 99.00% | 0.50% | 0.34% | 0.17% | NA |
| Indica II | 465 | 97.20% | 0.60% | 0.00% | 2.15% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 95.50% | 1.10% | 0.00% | 3.31% | NA |
| Temperate Japonica | 767 | 2.30% | 87.00% | 0.13% | 10.56% | NA |
| Tropical Japonica | 504 | 16.10% | 8.50% | 0.60% | 74.80% | NA |
| Japonica Intermediate | 241 | 9.50% | 48.50% | 0.00% | 41.91% | NA |
| VI/Aromatic | 96 | 28.10% | 11.50% | 0.00% | 60.42% | NA |
| Intermediate | 90 | 52.20% | 23.30% | 2.22% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000261110 | A -> G | LOC_Os10g01440.1 | upstream_gene_variant ; 3970.0bp to feature; MODIFIER | silent_mutation | Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 | N | N | N | N |
| vg1000261110 | A -> G | LOC_Os10g01430.1 | downstream_gene_variant ; 628.0bp to feature; MODIFIER | silent_mutation | Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 | N | N | N | N |
| vg1000261110 | A -> G | LOC_Os10g01430-LOC_Os10g01440 | intergenic_region ; MODIFIER | silent_mutation | Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 | N | N | N | N |
| vg1000261110 | A -> DEL | N | N | silent_mutation | Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000261110 | 9.31E-06 | 9.30E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 2.22E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 3.92E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 5.28E-08 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 2.71E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 2.84E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 3.93E-08 | mr1715 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 1.21E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 1.34E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 1.76E-07 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000261110 | NA | 2.00E-06 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |