\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000261110:

Variant ID: vg1000261110 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 261110
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATGTGCGCCATTAATAAATATATCATCTCTCTTCTCTACCAATCATATTTATTCTTCATCTATTATGAAGACATTATTTTCTCCCAATGCAAAACTT[A/G]
ATAGTGTCTAGTGCATAGGTTCTCGTGTTGAAGCTGTGTCTTGCATGAGACCTAGTTTTTTCCTCTCTTCACTCTTCTCTCTCTTAATTAATATAGTACC

Reverse complement sequence

GGTACTATATTAATTAAGAGAGAGAAGAGTGAAGAGAGGAAAAAACTAGGTCTCATGCAAGACACAGCTTCAACACGAGAACCTATGCACTAGACACTAT[T/C]
AAGTTTTGCATTGGGAGAAAATAATGTCTTCATAATAGATGAAGAATAAATATGATTGGTAGAGAAGAGAGATGATATATTTATTAATGGCGCACATTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 18.70% 0.25% 16.84% NA
All Indica  2759 98.00% 0.60% 0.07% 1.38% NA
All Japonica  1512 8.10% 54.70% 0.26% 36.97% NA
Aus  269 49.80% 3.70% 1.49% 44.98% NA
Indica I  595 99.00% 0.50% 0.34% 0.17% NA
Indica II  465 97.20% 0.60% 0.00% 2.15% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 95.50% 1.10% 0.00% 3.31% NA
Temperate Japonica  767 2.30% 87.00% 0.13% 10.56% NA
Tropical Japonica  504 16.10% 8.50% 0.60% 74.80% NA
Japonica Intermediate  241 9.50% 48.50% 0.00% 41.91% NA
VI/Aromatic  96 28.10% 11.50% 0.00% 60.42% NA
Intermediate  90 52.20% 23.30% 2.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000261110 A -> G LOC_Os10g01440.1 upstream_gene_variant ; 3970.0bp to feature; MODIFIER silent_mutation Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N
vg1000261110 A -> G LOC_Os10g01430.1 downstream_gene_variant ; 628.0bp to feature; MODIFIER silent_mutation Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N
vg1000261110 A -> G LOC_Os10g01430-LOC_Os10g01440 intergenic_region ; MODIFIER silent_mutation Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N
vg1000261110 A -> DEL N N silent_mutation Average:51.333; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000261110 9.31E-06 9.30E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 2.22E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 3.92E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 5.28E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 2.71E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 2.84E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 3.93E-08 mr1715 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 1.21E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 1.34E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 1.76E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000261110 NA 2.00E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251