\
| Variant ID: vg1000256952 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 256952 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCATGACAACGTCATGCTCTCCTGCGGCCGGCCTCTCTTGCACCATCCACGATAGGGTGGCATCAATGCGGGTGAGCTAGGCAGGGGCGGAGCCAGAAT[A/T]
AAACAAGGGGGTTTCACTCGTTTGCTTTACTCTGGTTTAAATCAAATTTAGCTTGATACGGGTGCATAAAATTAAACTAACGGGTATATATATGGTGAAA
TTTCACCATATATATACCCGTTAGTTTAATTTTATGCACCCGTATCAAGCTAAATTTGATTTAAACCAGAGTAAAGCAAACGAGTGAAACCCCCTTGTTT[T/A]
ATTCTGGCTCCGCCCCTGCCTAGCTCACCCGCATTGATGCCACCCTATCGTGGATGGTGCAAGAGAGGCCGGCCGCAGGAGAGCATGACGTTGTCATGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.10% | 2.40% | 0.06% | 16.48% | NA |
| All Indica | 2759 | 98.70% | 0.00% | 0.00% | 1.23% | NA |
| All Japonica | 1512 | 56.90% | 6.70% | 0.20% | 36.11% | NA |
| Aus | 269 | 54.30% | 0.00% | 0.00% | 45.72% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 0.20% | 0.00% | 2.15% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 97.10% | 0.00% | 0.00% | 2.93% | NA |
| Temperate Japonica | 767 | 77.10% | 12.80% | 0.13% | 10.04% | NA |
| Tropical Japonica | 504 | 25.60% | 0.00% | 0.40% | 74.01% | NA |
| Japonica Intermediate | 241 | 58.50% | 1.70% | 0.00% | 39.83% | NA |
| VI/Aromatic | 96 | 32.30% | 9.40% | 0.00% | 58.33% | NA |
| Intermediate | 90 | 76.70% | 1.10% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000256952 | A -> T | LOC_Os10g01420.1 | upstream_gene_variant ; 3935.0bp to feature; MODIFIER | silent_mutation | Average:11.182; most accessible tissue: Callus, score: 36.429 | N | N | N | N |
| vg1000256952 | A -> T | LOC_Os10g01430.1 | upstream_gene_variant ; 3042.0bp to feature; MODIFIER | silent_mutation | Average:11.182; most accessible tissue: Callus, score: 36.429 | N | N | N | N |
| vg1000256952 | A -> T | LOC_Os10g01420-LOC_Os10g01430 | intergenic_region ; MODIFIER | silent_mutation | Average:11.182; most accessible tissue: Callus, score: 36.429 | N | N | N | N |
| vg1000256952 | A -> DEL | N | N | silent_mutation | Average:11.182; most accessible tissue: Callus, score: 36.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000256952 | 5.73E-08 | 5.73E-08 | mr1038 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | 1.18E-06 | 1.18E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 9.99E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | 6.40E-07 | 6.40E-07 | mr1389 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 1.71E-08 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 1.95E-06 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | 7.10E-07 | 5.48E-10 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 1.02E-10 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | 7.63E-10 | 7.63E-10 | mr1389_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 3.35E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 6.04E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 1.69E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000256952 | NA | 5.83E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |