\
| Variant ID: vg1000250476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 250476 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTACAAAAGTTTTTGAATAAGACGAACGGTCAAACATGTGCTAGCTAAAAAGTTAACGGTATCAAATATTTAGAAATGGAGGGAGTATATAATGGGTA[C/T]
GTACCCAGACATCCTTTGCCCTGCTTGTCATCGTAATACTCATAAGGGTTCCCATGGTAGCCTGGGAGGCACCTGCAGAAGTAACCGGGGCCGTTGGTGG
CCACCAACGGCCCCGGTTACTTCTGCAGGTGCCTCCCAGGCTACCATGGGAACCCTTATGAGTATTACGATGACAAGCAGGGCAAAGGATGTCTGGGTAC[G/A]
TACCCATTATATACTCCCTCCATTTCTAAATATTTGATACCGTTAACTTTTTAGCTAGCACATGTTTGACCGTTCGTCTTATTCAAAAACTTTTGTAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 2.10% | 1.04% | 15.07% | NA |
| All Indica | 2759 | 98.60% | 0.00% | 0.36% | 1.01% | NA |
| All Japonica | 1512 | 57.90% | 6.00% | 1.85% | 34.26% | NA |
| Aus | 269 | 59.50% | 0.00% | 2.97% | 37.55% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.34% | 0.17% | NA |
| Indica II | 465 | 97.80% | 0.20% | 0.65% | 1.29% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 96.90% | 0.00% | 0.64% | 2.42% | NA |
| Temperate Japonica | 767 | 76.80% | 11.20% | 1.96% | 10.04% | NA |
| Tropical Japonica | 504 | 29.00% | 0.00% | 2.18% | 68.85% | NA |
| Japonica Intermediate | 241 | 58.50% | 1.70% | 0.83% | 39.00% | NA |
| VI/Aromatic | 96 | 35.40% | 9.40% | 2.08% | 53.12% | NA |
| Intermediate | 90 | 82.20% | 1.10% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000250476 | C -> T | LOC_Os10g01410.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:57.941; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1000250476 | C -> T | LOC_Os10g01420.1 | downstream_gene_variant ; 2275.0bp to feature; MODIFIER | silent_mutation | Average:57.941; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1000250476 | C -> DEL | N | N | silent_mutation | Average:57.941; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000250476 | 1.05E-07 | 1.05E-07 | mr1038 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | 1.66E-06 | 1.65E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | NA | 2.99E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | 3.07E-07 | 3.07E-07 | mr1389 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | NA | 2.54E-07 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | NA | 3.34E-06 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | NA | 2.55E-09 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | NA | 6.16E-09 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | 2.31E-09 | 2.31E-09 | mr1389_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000250476 | NA | 4.08E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |