\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000250476:

Variant ID: vg1000250476 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 250476
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTACAAAAGTTTTTGAATAAGACGAACGGTCAAACATGTGCTAGCTAAAAAGTTAACGGTATCAAATATTTAGAAATGGAGGGAGTATATAATGGGTA[C/T]
GTACCCAGACATCCTTTGCCCTGCTTGTCATCGTAATACTCATAAGGGTTCCCATGGTAGCCTGGGAGGCACCTGCAGAAGTAACCGGGGCCGTTGGTGG

Reverse complement sequence

CCACCAACGGCCCCGGTTACTTCTGCAGGTGCCTCCCAGGCTACCATGGGAACCCTTATGAGTATTACGATGACAAGCAGGGCAAAGGATGTCTGGGTAC[G/A]
TACCCATTATATACTCCCTCCATTTCTAAATATTTGATACCGTTAACTTTTTAGCTAGCACATGTTTGACCGTTCGTCTTATTCAAAAACTTTTGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 2.10% 1.04% 15.07% NA
All Indica  2759 98.60% 0.00% 0.36% 1.01% NA
All Japonica  1512 57.90% 6.00% 1.85% 34.26% NA
Aus  269 59.50% 0.00% 2.97% 37.55% NA
Indica I  595 99.50% 0.00% 0.34% 0.17% NA
Indica II  465 97.80% 0.20% 0.65% 1.29% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 96.90% 0.00% 0.64% 2.42% NA
Temperate Japonica  767 76.80% 11.20% 1.96% 10.04% NA
Tropical Japonica  504 29.00% 0.00% 2.18% 68.85% NA
Japonica Intermediate  241 58.50% 1.70% 0.83% 39.00% NA
VI/Aromatic  96 35.40% 9.40% 2.08% 53.12% NA
Intermediate  90 82.20% 1.10% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000250476 C -> T LOC_Os10g01410.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:57.941; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1000250476 C -> T LOC_Os10g01420.1 downstream_gene_variant ; 2275.0bp to feature; MODIFIER silent_mutation Average:57.941; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1000250476 C -> DEL N N silent_mutation Average:57.941; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000250476 1.05E-07 1.05E-07 mr1038 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 1.66E-06 1.65E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 NA 2.99E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 3.07E-07 3.07E-07 mr1389 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 NA 2.54E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 NA 3.34E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 NA 2.55E-09 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 NA 6.16E-09 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 2.31E-09 2.31E-09 mr1389_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000250476 NA 4.08E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251