Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000232970:

Variant ID: vg1000232970 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 232970
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGCCTGGAAACTATTGTCATGTTCGAGAAACCTATTAAGTATTTATCTTTCTGTCTTTTTTTTCTTCCAAAGCTAAACTCAATAGAATCATGTGTTTTT[T/G]
ATGACACTGCTTTTAACTGCATCAACACTTTGCTCAACTAGAGGATTTCCTCTTTAAAAAATATAAATTAGTAGGTACCTACCATTTCATTCCTTCTAGG

Reverse complement sequence

CCTAGAAGGAATGAAATGGTAGGTACCTACTAATTTATATTTTTTAAAGAGGAAATCCTCTAGTTGAGCAAAGTGTTGATGCAGTTAAAAGCAGTGTCAT[A/C]
AAAAACACATGATTCTATTGAGTTTAGCTTTGGAAGAAAAAAAAGACAGAAAGATAAATACTTAATAGGTTTCTCGAACATGACAATAGTTTCCAGGCAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	24.70%	8.40%	0.00%	NA
All Indica	2759	74.10%	14.90%	11.02%	0.00%	NA
All Japonica	1512	57.50%	40.00%	2.51%	0.00%	NA
Aus	269	49.80%	33.80%	16.36%	0.00%	NA
Indica I	595	82.90%	8.70%	8.40%	0.00%	NA
Indica II	465	63.90%	22.20%	13.98%	0.00%	NA
Indica III	913	71.60%	16.90%	11.50%	0.00%	NA
Indica Intermediate	786	76.50%	12.80%	10.69%	0.00%	NA
Temperate Japonica	767	88.40%	10.80%	0.78%	0.00%	NA
Tropical Japonica	504	12.30%	82.90%	4.76%	0.00%	NA
Japonica Intermediate	241	53.50%	43.20%	3.32%	0.00%	NA
VI/Aromatic	96	54.20%	40.60%	5.21%	0.00%	NA
Intermediate	90	66.70%	26.70%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000232970	T -> G	LOC_Os10g01380.1	intron_variant ; MODIFIER	silent_mutation	Average:13.193; most accessible tissue: Minghui63 root, score: 21.615	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000232970	6.75E-07	6.75E-07	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	9.17E-09	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	1.24E-06	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	1.10E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	9.64E-08	NA	mr1300	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	4.61E-08	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	1.17E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	2.79E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	3.08E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	4.55E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	3.75E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	1.47E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	6.31E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	4.64E-09	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	2.34E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	9.40E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	4.37E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	9.33E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	7.56E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	3.85E-10	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	4.01E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	4.48E-12	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970	NA	3.98E-09	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251