\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000232970:

Variant ID: vg1000232970 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 232970
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCCTGGAAACTATTGTCATGTTCGAGAAACCTATTAAGTATTTATCTTTCTGTCTTTTTTTTCTTCCAAAGCTAAACTCAATAGAATCATGTGTTTTT[T/G]
ATGACACTGCTTTTAACTGCATCAACACTTTGCTCAACTAGAGGATTTCCTCTTTAAAAAATATAAATTAGTAGGTACCTACCATTTCATTCCTTCTAGG

Reverse complement sequence

CCTAGAAGGAATGAAATGGTAGGTACCTACTAATTTATATTTTTTAAAGAGGAAATCCTCTAGTTGAGCAAAGTGTTGATGCAGTTAAAAGCAGTGTCAT[A/C]
AAAAACACATGATTCTATTGAGTTTAGCTTTGGAAGAAAAAAAAGACAGAAAGATAAATACTTAATAGGTTTCTCGAACATGACAATAGTTTCCAGGCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 24.70% 8.40% 0.00% NA
All Indica  2759 74.10% 14.90% 11.02% 0.00% NA
All Japonica  1512 57.50% 40.00% 2.51% 0.00% NA
Aus  269 49.80% 33.80% 16.36% 0.00% NA
Indica I  595 82.90% 8.70% 8.40% 0.00% NA
Indica II  465 63.90% 22.20% 13.98% 0.00% NA
Indica III  913 71.60% 16.90% 11.50% 0.00% NA
Indica Intermediate  786 76.50% 12.80% 10.69% 0.00% NA
Temperate Japonica  767 88.40% 10.80% 0.78% 0.00% NA
Tropical Japonica  504 12.30% 82.90% 4.76% 0.00% NA
Japonica Intermediate  241 53.50% 43.20% 3.32% 0.00% NA
VI/Aromatic  96 54.20% 40.60% 5.21% 0.00% NA
Intermediate  90 66.70% 26.70% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000232970 T -> G LOC_Os10g01380.1 intron_variant ; MODIFIER silent_mutation Average:13.193; most accessible tissue: Minghui63 root, score: 21.615 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000232970 6.75E-07 6.75E-07 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 9.17E-09 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 1.24E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 1.10E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 9.64E-08 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 4.61E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 1.17E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 2.79E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 3.08E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 4.55E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 3.75E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 1.47E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 6.31E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 4.64E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 2.34E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 9.40E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 4.37E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 9.33E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 7.56E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 3.85E-10 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 4.01E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 4.48E-12 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000232970 NA 3.98E-09 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251