\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000231687:

Variant ID: vg1000231687 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 231687
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACCAAGAAAAACCACCAAAGGTCCTCTGCCCTCAAATCTACCAAAACTCTCTCTCTCTCAGAATTCAGCACTTAGTAAATTCTCCGTGTGTCTCAAA[C/A]
TATAGGAGCATTCTGATTTTGTCCCAAATTATTTCGCCACCTACTCCCTCATCTCAACCAATCAAAATCCTCTCTTATTTAATTTGTTCACTTACATTAC

Reverse complement sequence

GTAATGTAAGTGAACAAATTAAATAAGAGAGGATTTTGATTGGTTGAGATGAGGGAGTAGGTGGCGAAATAATTTGGGACAAAATCAGAATGCTCCTATA[G/T]
TTTGAGACACACGGAGAATTTACTAAGTGCTGAATTCTGAGAGAGAGAGAGTTTTGGTAGATTTGAGGGCAGAGGACCTTTGGTGGTTTTTCTTGGTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 36.20% 1.14% 1.18% NA
All Indica  2759 69.40% 29.20% 0.65% 0.65% NA
All Japonica  1512 40.10% 55.20% 2.31% 2.38% NA
Aus  269 91.40% 8.20% 0.00% 0.37% NA
Indica I  595 78.80% 19.50% 0.84% 0.84% NA
Indica II  465 52.00% 47.30% 0.65% 0.00% NA
Indica III  913 75.50% 23.10% 0.77% 0.66% NA
Indica Intermediate  786 65.60% 33.10% 0.38% 0.89% NA
Temperate Japonica  767 11.10% 86.00% 1.96% 0.91% NA
Tropical Japonica  504 81.00% 10.30% 3.57% 5.16% NA
Japonica Intermediate  241 46.90% 51.00% 0.83% 1.24% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 56.70% 42.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000231687 C -> A LOC_Os10g01380.1 intron_variant ; MODIFIER silent_mutation Average:21.684; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N
vg1000231687 C -> DEL N N silent_mutation Average:21.684; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000231687 2.83E-06 2.83E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 1.63E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 5.62E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 7.17E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 4.97E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 5.79E-10 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 1.99E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 1.45E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 1.13E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 8.29E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 2.91E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 6.32E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 2.51E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 1.06E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 6.70E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 1.30E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 5.17E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 4.55E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 1.80E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 3.06E-11 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 9.58E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 2.92E-09 NA mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 1.48E-06 3.74E-13 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000231687 NA 7.68E-09 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251