\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000221774:

Variant ID: vg1000221774 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 221774
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CATAATATAAGGGATTTTGAGTTTTTACTTGTATTGTTTGACTACTCGTCTTATTCAAAAAAAATTGTGCAAATATAAAAAACGAAAAGTTGTGCTTAAA[G/A]
TACTTTAGATAATAAAGTAAGTCACAAAAAAATAAATAATAATTCTAAATTTTTTTTAATAAGACGAGTGATCAAACAGTACAAACAAAAACTCAAAATC

Reverse complement sequence

GATTTTGAGTTTTTGTTTGTACTGTTTGATCACTCGTCTTATTAAAAAAAATTTAGAATTATTATTTATTTTTTTGTGACTTACTTTATTATCTAAAGTA[C/T]
TTTAAGCACAACTTTTCGTTTTTTATATTTGCACAATTTTTTTTGAATAAGACGAGTAGTCAAACAATACAAGTAAAAACTCAAAATCCCTTATATTATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.30% 0.83% 0.00% NA
All Indica  2759 69.50% 29.60% 0.83% 0.00% NA
All Japonica  1512 44.30% 54.80% 0.93% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 79.70% 19.50% 0.84% 0.00% NA
Indica II  465 51.40% 48.40% 0.22% 0.00% NA
Indica III  913 75.50% 23.40% 1.10% 0.00% NA
Indica Intermediate  786 65.60% 33.50% 0.89% 0.00% NA
Temperate Japonica  767 14.70% 85.00% 0.26% 0.00% NA
Tropical Japonica  504 87.10% 10.90% 1.98% 0.00% NA
Japonica Intermediate  241 49.00% 50.20% 0.83% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000221774 G -> A LOC_Os10g01360.1 upstream_gene_variant ; 1170.0bp to feature; MODIFIER silent_mutation Average:41.941; most accessible tissue: Minghui63 root, score: 64.607 N N N N
vg1000221774 G -> A LOC_Os10g01370.1 downstream_gene_variant ; 1759.0bp to feature; MODIFIER silent_mutation Average:41.941; most accessible tissue: Minghui63 root, score: 64.607 N N N N
vg1000221774 G -> A LOC_Os10g01360-LOC_Os10g01370 intergenic_region ; MODIFIER silent_mutation Average:41.941; most accessible tissue: Minghui63 root, score: 64.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000221774 5.68E-07 5.67E-07 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 3.16E-06 mr1062 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 8.66E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 2.26E-06 2.26E-06 mr1260 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 5.21E-06 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 2.64E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 3.43E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 3.06E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 4.52E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 4.54E-09 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 8.33E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 6.57E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 1.03E-08 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 2.70E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 9.53E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 5.19E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 6.39E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 7.56E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 2.15E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 7.16E-06 4.08E-12 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 6.47E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221774 NA 4.42E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251