\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000221182:

Variant ID: vg1000221182 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 221182
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATCTCCACAATTTTCATTTAATTTCCCACGTCAACACACCACGTCAGCACGCACACGGTGGAATTTTACATGGAAATACCCGCTACTAATATATACTC[C/T]
CTCCGTATTTTAACGTATGACGCCGTTGACTTTTTAACAAACGTTTGACCTTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGAC

Reverse complement sequence

GTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAAGGTCAAACGTTTGTTAAAAAGTCAACGGCGTCATACGTTAAAATACGGAG[G/A]
GAGTATATATTAGTAGCGGGTATTTCCATGTAAAATTCCACCGTGTGCGTGCTGACGTGGTGTGTTGACGTGGGAAATTAAATGAAAATTGTGGAGATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.20% 0.34% 0.19% NA
All Indica  2759 69.40% 29.80% 0.51% 0.29% NA
All Japonica  1512 56.70% 43.10% 0.07% 0.07% NA
Aus  269 39.80% 60.20% 0.00% 0.00% NA
Indica I  595 78.20% 21.20% 0.50% 0.17% NA
Indica II  465 57.40% 41.50% 0.43% 0.65% NA
Indica III  913 67.50% 31.70% 0.55% 0.33% NA
Indica Intermediate  786 72.00% 27.40% 0.51% 0.13% NA
Temperate Japonica  767 88.10% 11.70% 0.13% 0.00% NA
Tropical Japonica  504 11.50% 88.30% 0.00% 0.20% NA
Japonica Intermediate  241 51.50% 48.50% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000221182 C -> T LOC_Os10g01360.1 upstream_gene_variant ; 578.0bp to feature; MODIFIER silent_mutation Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 N N N N
vg1000221182 C -> T LOC_Os10g01370.1 downstream_gene_variant ; 2351.0bp to feature; MODIFIER silent_mutation Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 N N N N
vg1000221182 C -> T LOC_Os10g01360-LOC_Os10g01370 intergenic_region ; MODIFIER silent_mutation Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 N N N N
vg1000221182 C -> DEL N N silent_mutation Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000221182 2.54E-06 2.54E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 7.32E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 1.23E-06 1.48E-08 mr1168 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 1.85E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 5.47E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 9.83E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 9.51E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 7.45E-06 1.17E-07 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 4.10E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 1.73E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 2.83E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 1.94E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 9.13E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 2.46E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 4.66E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 1.69E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 4.58E-10 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 7.22E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 3.37E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 3.50E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 2.19E-11 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 9.10E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 5.87E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182 NA 6.67E-09 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251