Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000221182:

Variant ID: vg1000221182 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 221182
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATCTCCACAATTTTCATTTAATTTCCCACGTCAACACACCACGTCAGCACGCACACGGTGGAATTTTACATGGAAATACCCGCTACTAATATATACTC[C/T]
CTCCGTATTTTAACGTATGACGCCGTTGACTTTTTAACAAACGTTTGACCTTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGAC

Reverse complement sequence

GTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAAGGTCAAACGTTTGTTAAAAAGTCAACGGCGTCATACGTTAAAATACGGAG[G/A]
GAGTATATATTAGTAGCGGGTATTTCCATGTAAAATTCCACCGTGTGCGTGCTGACGTGGTGTGTTGACGTGGGAAATTAAATGAAAATTGTGGAGATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.20%	0.34%	0.19%	NA
All Indica	2759	69.40%	29.80%	0.51%	0.29%	NA
All Japonica	1512	56.70%	43.10%	0.07%	0.07%	NA
Aus	269	39.80%	60.20%	0.00%	0.00%	NA
Indica I	595	78.20%	21.20%	0.50%	0.17%	NA
Indica II	465	57.40%	41.50%	0.43%	0.65%	NA
Indica III	913	67.50%	31.70%	0.55%	0.33%	NA
Indica Intermediate	786	72.00%	27.40%	0.51%	0.13%	NA
Temperate Japonica	767	88.10%	11.70%	0.13%	0.00%	NA
Tropical Japonica	504	11.50%	88.30%	0.00%	0.20%	NA
Japonica Intermediate	241	51.50%	48.50%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000221182	C -> T	LOC_Os10g01360.1	upstream_gene_variant ; 578.0bp to feature; MODIFIER	silent_mutation	Average:45.392; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg1000221182	C -> T	LOC_Os10g01370.1	downstream_gene_variant ; 2351.0bp to feature; MODIFIER	silent_mutation	Average:45.392; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg1000221182	C -> T	LOC_Os10g01360-LOC_Os10g01370	intergenic_region ; MODIFIER	silent_mutation	Average:45.392; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N
vg1000221182	C -> DEL	N	N	silent_mutation	Average:45.392; most accessible tissue: Minghui63 root, score: 82.349	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000221182	2.54E-06	2.54E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	7.32E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	1.23E-06	1.48E-08	mr1168	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	1.85E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	5.47E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	9.83E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	9.51E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	7.45E-06	1.17E-07	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	4.10E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	1.73E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	2.83E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	1.94E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	9.13E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	2.46E-08	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	4.66E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	1.69E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	4.58E-10	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	7.22E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	3.37E-09	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	3.50E-07	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	2.19E-11	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	9.10E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	5.87E-06	mr1952_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000221182	NA	6.67E-09	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251