\
| Variant ID: vg1000221182 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 221182 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAATCTCCACAATTTTCATTTAATTTCCCACGTCAACACACCACGTCAGCACGCACACGGTGGAATTTTACATGGAAATACCCGCTACTAATATATACTC[C/T]
CTCCGTATTTTAACGTATGACGCCGTTGACTTTTTAACAAACGTTTGACCTTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGAC
GTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAAGGTCAAACGTTTGTTAAAAAGTCAACGGCGTCATACGTTAAAATACGGAG[G/A]
GAGTATATATTAGTAGCGGGTATTTCCATGTAAAATTCCACCGTGTGCGTGCTGACGTGGTGTGTTGACGTGGGAAATTAAATGAAAATTGTGGAGATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 37.20% | 0.34% | 0.19% | NA |
| All Indica | 2759 | 69.40% | 29.80% | 0.51% | 0.29% | NA |
| All Japonica | 1512 | 56.70% | 43.10% | 0.07% | 0.07% | NA |
| Aus | 269 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.20% | 21.20% | 0.50% | 0.17% | NA |
| Indica II | 465 | 57.40% | 41.50% | 0.43% | 0.65% | NA |
| Indica III | 913 | 67.50% | 31.70% | 0.55% | 0.33% | NA |
| Indica Intermediate | 786 | 72.00% | 27.40% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 88.10% | 11.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 11.50% | 88.30% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000221182 | C -> T | LOC_Os10g01360.1 | upstream_gene_variant ; 578.0bp to feature; MODIFIER | silent_mutation | Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg1000221182 | C -> T | LOC_Os10g01370.1 | downstream_gene_variant ; 2351.0bp to feature; MODIFIER | silent_mutation | Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg1000221182 | C -> T | LOC_Os10g01360-LOC_Os10g01370 | intergenic_region ; MODIFIER | silent_mutation | Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| vg1000221182 | C -> DEL | N | N | silent_mutation | Average:45.392; most accessible tissue: Minghui63 root, score: 82.349 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000221182 | 2.54E-06 | 2.54E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 7.32E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | 1.23E-06 | 1.48E-08 | mr1168 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 1.85E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 5.47E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 9.83E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 9.51E-09 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | 7.45E-06 | 1.17E-07 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 4.10E-06 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 1.73E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 2.83E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 1.94E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 9.13E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 2.46E-08 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 4.66E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 1.69E-06 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 4.58E-10 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 7.22E-07 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 3.37E-09 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 3.50E-07 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 2.19E-11 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 9.10E-06 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 5.87E-06 | mr1952_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000221182 | NA | 6.67E-09 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |