RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1000218960:

Variant ID: vg1000218960 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 218960
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGGTTTATGTCCGAACTTGCCGACTAGGTCCTCGTGGCGAATGCCTTTAGTAAAGGCGGCGATGATGACGTCGTCGGTGATGTTGGAGATCTTGTTGC[A/G]
TTGCTCGGAGAAGCGTCGGATGTAATCTCGAAGGGATTCTCCAGACTTCTGAACGACGTTGTAGAGATCAAACTGTGTGCCGGGGCATTCAAAGGTGCCC

Reverse complement sequence

GGGCACCTTTGAATGCCCCGGCACACAGTTTGATCTCTACAACGTCGTTCAGAAGTCTGGAGAATCCCTTCGAGATTACATCCGACGCTTCTCCGAGCAA[T/C]
GCAACAAGATCTCCAACATCACCGACGACGTCATCATCGCCGCCTTTACTAAAGGCATTCGCCACGAGGACCTAGTCGGCAAGTTCGGACATAAACCTCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.10%	18.10%	7.58%	55.14%	NA
All Indica	2759	1.70%	28.70%	12.21%	57.38%	NA
All Japonica	1512	54.00%	2.30%	0.33%	43.39%	NA
Aus	269	4.10%	5.20%	2.23%	88.48%	NA
Indica I	595	2.90%	18.50%	13.11%	65.55%	NA
Indica II	465	1.70%	46.70%	8.17%	43.44%	NA
Indica III	913	0.70%	23.40%	14.68%	61.23%	NA
Indica Intermediate	786	1.90%	32.10%	11.07%	54.96%	NA
Temperate Japonica	767	84.60%	2.20%	0.26%	12.91%	NA
Tropical Japonica	504	9.30%	2.40%	0.60%	87.70%	NA
Japonica Intermediate	241	49.80%	2.50%	0.00%	47.72%	NA
VI/Aromatic	96	10.40%	1.00%	4.17%	84.38%	NA
Intermediate	90	24.40%	15.60%	6.67%	53.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000218960	A -> G	LOC_Os10g01360.1	missense_variant ; p.Cys454Arg; MODERATE	nonsynonymous_codon ; C454R	Average:20.234; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	benign	-0.476	TOLERATED	1.00
vg1000218960	A -> DEL	LOC_Os10g01360.1	N	frameshift_variant	Average:20.234; most accessible tissue: Zhenshan97 flag leaf, score: 48.165	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000218960	NA	4.35E-06	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000218960	2.87E-06	2.87E-06	mr1644	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000218960	NA	8.69E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000218960	NA	6.35E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000218960	NA	8.10E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1000218960:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact