Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000207799:

Variant ID: vg1000207799 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 207799
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGATCTAGTCTATTGGTGTAAAATAATGGGTCCACTAATTTAAATGAAAATCAACGGTGGGATTAGATAGTACCATGTGGAGGCTTAGGAGCGTTTATA[T/G]
AAGTACCACATGGAAGCTTAAGAGCATTTTTAGAAGTTTAATGGACTTTTAGTATATAATAGATAGATAATAGATAGATAGATAATGCATCAAATAAACA

Reverse complement sequence

TGTTTATTTGATGCATTATCTATCTATCTATTATCTATCTATTATATACTAAAAGTCCATTAAACTTCTAAAAATGCTCTTAAGCTTCCATGTGGTACTT[A/C]
TATAAACGCTCCTAAGCCTCCACATGGTACTATCTAATCCCACCGTTGATTTTCATTTAAATTAGTGGACCCATTATTTTACACCAATAGACTAGATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.60%	18.70%	40.63%	19.02%	NA
All Indica	2759	34.30%	1.10%	41.03%	23.67%	NA
All Japonica	1512	2.20%	54.10%	38.10%	5.62%	NA
Aus	269	8.60%	3.30%	49.81%	38.29%	NA
Indica I	595	20.30%	2.00%	37.98%	39.66%	NA
Indica II	465	48.80%	1.50%	37.42%	12.26%	NA
Indica III	913	34.10%	0.10%	45.78%	20.04%	NA
Indica Intermediate	786	36.40%	1.10%	39.95%	22.52%	NA
Temperate Japonica	767	1.30%	85.40%	10.82%	2.48%	NA
Tropical Japonica	504	3.40%	8.50%	76.59%	11.51%	NA
Japonica Intermediate	241	2.50%	49.80%	44.40%	3.32%	NA
VI/Aromatic	96	3.10%	9.40%	41.67%	45.83%	NA
Intermediate	90	21.10%	21.10%	42.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000207799	T -> G	LOC_Os10g01330.1	upstream_gene_variant ; 4775.0bp to feature; MODIFIER	silent_mutation	Average:48.935; most accessible tissue: Callus, score: 85.688	N	N	N	N
vg1000207799	T -> G	LOC_Os10g01350.1	upstream_gene_variant ; 3498.0bp to feature; MODIFIER	silent_mutation	Average:48.935; most accessible tissue: Callus, score: 85.688	N	N	N	N
vg1000207799	T -> G	LOC_Os10g01340.1	downstream_gene_variant ; 1074.0bp to feature; MODIFIER	silent_mutation	Average:48.935; most accessible tissue: Callus, score: 85.688	N	N	N	N
vg1000207799	T -> G	LOC_Os10g01330-LOC_Os10g01340	intergenic_region ; MODIFIER	silent_mutation	Average:48.935; most accessible tissue: Callus, score: 85.688	N	N	N	N
vg1000207799	T -> DEL	N	N	silent_mutation	Average:48.935; most accessible tissue: Callus, score: 85.688	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000207799	1.33E-06	1.33E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	7.99E-16	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	4.13E-08	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	2.54E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	2.99E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	8.31E-14	3.84E-35	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.40E-08	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	4.30E-14	9.01E-53	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.75E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.70E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	2.91E-11	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.37E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.72E-10	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.79E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.89E-10	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	3.10E-09	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	2.66E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.38E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	6.16E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.25E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	7.26E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	4.10E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	1.37E-16	4.28E-60	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.20E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	1.64E-08	3.51E-15	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	6.14E-06	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.38E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	1.31E-08	NA	mr1168_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	5.50E-18	1.02E-52	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	2.15E-12	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	4.70E-06	NA	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	2.81E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	8.33E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	8.98E-11	1.34E-22	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799	NA	1.10E-08	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251