\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000207799:

Variant ID: vg1000207799 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 207799
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGATCTAGTCTATTGGTGTAAAATAATGGGTCCACTAATTTAAATGAAAATCAACGGTGGGATTAGATAGTACCATGTGGAGGCTTAGGAGCGTTTATA[T/G]
AAGTACCACATGGAAGCTTAAGAGCATTTTTAGAAGTTTAATGGACTTTTAGTATATAATAGATAGATAATAGATAGATAGATAATGCATCAAATAAACA

Reverse complement sequence

TGTTTATTTGATGCATTATCTATCTATCTATTATCTATCTATTATATACTAAAAGTCCATTAAACTTCTAAAAATGCTCTTAAGCTTCCATGTGGTACTT[A/C]
TATAAACGCTCCTAAGCCTCCACATGGTACTATCTAATCCCACCGTTGATTTTCATTTAAATTAGTGGACCCATTATTTTACACCAATAGACTAGATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.60% 18.70% 40.63% 19.02% NA
All Indica  2759 34.30% 1.10% 41.03% 23.67% NA
All Japonica  1512 2.20% 54.10% 38.10% 5.62% NA
Aus  269 8.60% 3.30% 49.81% 38.29% NA
Indica I  595 20.30% 2.00% 37.98% 39.66% NA
Indica II  465 48.80% 1.50% 37.42% 12.26% NA
Indica III  913 34.10% 0.10% 45.78% 20.04% NA
Indica Intermediate  786 36.40% 1.10% 39.95% 22.52% NA
Temperate Japonica  767 1.30% 85.40% 10.82% 2.48% NA
Tropical Japonica  504 3.40% 8.50% 76.59% 11.51% NA
Japonica Intermediate  241 2.50% 49.80% 44.40% 3.32% NA
VI/Aromatic  96 3.10% 9.40% 41.67% 45.83% NA
Intermediate  90 21.10% 21.10% 42.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000207799 T -> G LOC_Os10g01330.1 upstream_gene_variant ; 4775.0bp to feature; MODIFIER silent_mutation Average:48.935; most accessible tissue: Callus, score: 85.688 N N N N
vg1000207799 T -> G LOC_Os10g01350.1 upstream_gene_variant ; 3498.0bp to feature; MODIFIER silent_mutation Average:48.935; most accessible tissue: Callus, score: 85.688 N N N N
vg1000207799 T -> G LOC_Os10g01340.1 downstream_gene_variant ; 1074.0bp to feature; MODIFIER silent_mutation Average:48.935; most accessible tissue: Callus, score: 85.688 N N N N
vg1000207799 T -> G LOC_Os10g01330-LOC_Os10g01340 intergenic_region ; MODIFIER silent_mutation Average:48.935; most accessible tissue: Callus, score: 85.688 N N N N
vg1000207799 T -> DEL N N silent_mutation Average:48.935; most accessible tissue: Callus, score: 85.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000207799 1.33E-06 1.33E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 7.99E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 4.13E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 2.54E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 2.99E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 8.31E-14 3.84E-35 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.40E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 4.30E-14 9.01E-53 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.75E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.70E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 2.91E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.37E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.72E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.79E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.89E-10 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 3.10E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 2.66E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.38E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 6.16E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.25E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 7.26E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 4.10E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 1.37E-16 4.28E-60 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.20E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 1.64E-08 3.51E-15 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 6.14E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.38E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 1.31E-08 NA mr1168_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 5.50E-18 1.02E-52 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 2.15E-12 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 4.70E-06 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 2.81E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 8.33E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 8.98E-11 1.34E-22 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000207799 NA 1.10E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251