Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000204921:

Variant ID: vg1000204921 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 204921
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

TATAAAGTAGTATCGAAGTATTAGCCAATACATGCTAGATCTATCTGATCGGCTATGCTATAAACATATATAGTCCTGTTATTAATATATATTTCAATCT[G/A]
AGTGATTTATACTGTCTCGGCATGGCGACTGATCTATCCCAATCACTTGATTTAAGTATATATCGATATAAGAACTATATATTGGAAATATCTACAGCCG

Reverse complement sequence

CGGCTGTAGATATTTCCAATATATAGTTCTTATATCGATATATACTTAAATCAAGTGATTGGGATAGATCAGTCGCCATGCCGAGACAGTATAAATCACT[C/T]
AGATTGAAATATATATTAATAACAGGACTATATATGTTTATAGCATAGCCGATCAGATAGATCTAGCATGTATTGGCTAATACTTCGATACTACTTTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.10%	17.80%	0.55%	62.53%	NA
All Indica	2759	1.40%	28.60%	0.62%	69.41%	NA
All Japonica	1512	54.50%	1.50%	0.26%	43.72%	NA
Aus	269	4.10%	4.80%	0.37%	90.71%	NA
Indica I	595	2.20%	18.50%	0.67%	78.66%	NA
Indica II	465	1.50%	46.20%	0.43%	51.83%	NA
Indica III	913	0.70%	23.20%	0.22%	75.90%	NA
Indica Intermediate	786	1.70%	31.90%	1.15%	65.27%	NA
Temperate Japonica	767	85.70%	0.90%	0.52%	12.91%	NA
Tropical Japonica	504	9.10%	2.20%	0.00%	88.69%	NA
Japonica Intermediate	241	50.20%	2.10%	0.00%	47.72%	NA
VI/Aromatic	96	9.40%	1.00%	1.04%	88.54%	NA
Intermediate	90	22.20%	18.90%	3.33%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000204921	G -> A	LOC_Os10g01330.1	upstream_gene_variant ; 1897.0bp to feature; MODIFIER	silent_mutation	Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1000204921	G -> A	LOC_Os10g01320.1	downstream_gene_variant ; 4709.0bp to feature; MODIFIER	silent_mutation	Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1000204921	G -> A	LOC_Os10g01340.1	downstream_gene_variant ; 3952.0bp to feature; MODIFIER	silent_mutation	Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1000204921	G -> A	LOC_Os10g01330-LOC_Os10g01340	intergenic_region ; MODIFIER	silent_mutation	Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1000204921	G -> DEL	N	N	silent_mutation	Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000204921	4.61E-06	4.60E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.22E-17	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.47E-08	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	8.83E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.05E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	8.84E-15	3.89E-36	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	3.21E-08	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	7.84E-14	1.49E-52	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	4.31E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	4.57E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.36E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	4.92E-11	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.08E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	6.27E-13	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	9.96E-08	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	3.30E-11	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	1.27E-09	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	1.34E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.48E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	1.41E-06	1.41E-06	mr1736	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	1.35E-08	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	9.14E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	8.88E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	4.11E-11	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.54E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	7.11E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	6.78E-18	6.38E-62	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.79E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	8.34E-09	3.10E-15	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	9.11E-19	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	8.29E-07	NA	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	1.86E-17	2.68E-52	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	3.71E-12	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	5.63E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	1.86E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	1.15E-10	1.91E-22	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921	NA	2.45E-08	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251