\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000204921:

Variant ID: vg1000204921 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 204921
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TATAAAGTAGTATCGAAGTATTAGCCAATACATGCTAGATCTATCTGATCGGCTATGCTATAAACATATATAGTCCTGTTATTAATATATATTTCAATCT[G/A]
AGTGATTTATACTGTCTCGGCATGGCGACTGATCTATCCCAATCACTTGATTTAAGTATATATCGATATAAGAACTATATATTGGAAATATCTACAGCCG

Reverse complement sequence

CGGCTGTAGATATTTCCAATATATAGTTCTTATATCGATATATACTTAAATCAAGTGATTGGGATAGATCAGTCGCCATGCCGAGACAGTATAAATCACT[C/T]
AGATTGAAATATATATTAATAACAGGACTATATATGTTTATAGCATAGCCGATCAGATAGATCTAGCATGTATTGGCTAATACTTCGATACTACTTTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.10% 17.80% 0.55% 62.53% NA
All Indica  2759 1.40% 28.60% 0.62% 69.41% NA
All Japonica  1512 54.50% 1.50% 0.26% 43.72% NA
Aus  269 4.10% 4.80% 0.37% 90.71% NA
Indica I  595 2.20% 18.50% 0.67% 78.66% NA
Indica II  465 1.50% 46.20% 0.43% 51.83% NA
Indica III  913 0.70% 23.20% 0.22% 75.90% NA
Indica Intermediate  786 1.70% 31.90% 1.15% 65.27% NA
Temperate Japonica  767 85.70% 0.90% 0.52% 12.91% NA
Tropical Japonica  504 9.10% 2.20% 0.00% 88.69% NA
Japonica Intermediate  241 50.20% 2.10% 0.00% 47.72% NA
VI/Aromatic  96 9.40% 1.00% 1.04% 88.54% NA
Intermediate  90 22.20% 18.90% 3.33% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000204921 G -> A LOC_Os10g01330.1 upstream_gene_variant ; 1897.0bp to feature; MODIFIER silent_mutation Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1000204921 G -> A LOC_Os10g01320.1 downstream_gene_variant ; 4709.0bp to feature; MODIFIER silent_mutation Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1000204921 G -> A LOC_Os10g01340.1 downstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1000204921 G -> A LOC_Os10g01330-LOC_Os10g01340 intergenic_region ; MODIFIER silent_mutation Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1000204921 G -> DEL N N silent_mutation Average:21.454; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000204921 4.61E-06 4.60E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.22E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.47E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 8.83E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.05E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 8.84E-15 3.89E-36 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 3.21E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 7.84E-14 1.49E-52 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 4.31E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 4.57E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.36E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 4.92E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.08E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 6.27E-13 mr1549 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 9.96E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 3.30E-11 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 1.27E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 1.34E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.48E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 1.41E-06 1.41E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 1.35E-08 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 9.14E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 8.88E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 4.11E-11 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.54E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 7.11E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 6.78E-18 6.38E-62 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.79E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 8.34E-09 3.10E-15 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 9.11E-19 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 8.29E-07 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 1.86E-17 2.68E-52 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 3.71E-12 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 5.63E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 1.86E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 1.15E-10 1.91E-22 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000204921 NA 2.45E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251