Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000146800:

Variant ID: vg1000146800 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 146800
Reference Allele: C	Alternative Allele: A,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAATATTTGCTAATAATAGATTAATTAGGCTTAATAGATTCGTCTCGCAGTTTACAAGCGGAATCTGTAATTTGTTTTGTTATTAGTTTATGTTTAATA[C/A,T]
TTCAAATGTGTATCTGTATACGTTAAATTTTTTTTGCCAAAACAAGTAAACACGGCCGAAGAAGAAAAGGGTATTTGGATGGAAAAACATATATAAGAGC

Reverse complement sequence

GCTCTTATATATGTTTTTCCATCCAAATACCCTTTTCTTCTTCGGCCGTGTTTACTTGTTTTGGCAAAAAAAATTTAACGTATACAGATACACATTTGAA[G/T,A]
TATTAAACATAAACTAATAACAAAACAAATTACAGATTCCGCTTGTAAACTGCGAGACGAATCTATTAAGCCTAATTAATCTATTATTAGCAAATATTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.20%	21.80%	0.49%	0.55%	NA
All Indica	2759	97.00%	1.30%	0.76%	0.94%	NA
All Japonica	1512	43.20%	56.70%	0.13%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	97.50%	0.50%	1.18%	0.84%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	94.40%	2.50%	0.88%	2.19%	NA
Indica Intermediate	786	98.10%	1.10%	0.64%	0.13%	NA
Temperate Japonica	767	12.90%	87.10%	0.00%	0.00%	NA
Tropical Japonica	504	87.10%	12.50%	0.40%	0.00%	NA
Japonica Intermediate	241	47.70%	52.30%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000146800	C -> T	LOC_Os10g01210-LOC_Os10g01230	intergenic_region ; MODIFIER	N	Average:48.385; most accessible tissue: Callus, score: 82.284	N	N	N	N
vg1000146800	C -> A	LOC_Os10g01210-LOC_Os10g01230	intergenic_region ; MODIFIER	silent_mutation	Average:48.385; most accessible tissue: Callus, score: 82.284	N	N	N	N
vg1000146800	C -> DEL	N	N	silent_mutation	Average:48.385; most accessible tissue: Callus, score: 82.284	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000146800	NA	1.43E-16	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000146800	NA	3.13E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	1.48E-07	1.47E-07	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	2.24E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	6.28E-07	1.19E-19	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	6.15E-10	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	3.37E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	1.61E-06	2.05E-20	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	3.46E-10	mr1179	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	4.09E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	1.37E-10	3.92E-30	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	1.60E-08	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	9.80E-11	2.54E-46	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	2.60E-10	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	3.89E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	7.21E-06	mr1428	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	1.54E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	1.63E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	2.76E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	3.83E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	7.75E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	1.80E-08	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	4.50E-06	mr1588	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	7.37E-06	7.43E-12	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	1.60E-10	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	2.81E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	1.83E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	4.25E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	6.98E-09	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	3.55E-06	3.56E-06	mr1736	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	4.73E-08	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	7.24E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	3.43E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	2.72E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	5.96E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	9.03E-13	7.72E-52	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	4.60E-11	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	1.26E-07	2.76E-12	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	7.39E-07	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	2.27E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	3.64E-13	2.27E-43	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	1.36E-06	1.77E-13	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	NA	2.38E-10	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	3.27E-08	1.97E-17	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000146800	6.48E-06	5.24E-10	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251