Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000109717:

Variant ID: vg1000109717 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 109717
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCACCCATCGATGCTAATTAATGAGCCGATTGAGCAGTCACTTCGTAATCAGCAGCGGTTGAATGCTTCTTGTTTTTGTGTAGAAGTCGCCTTTTTAC[G/T]
GGACAAACTCTTCTCGCTAGAAATCATCTCTTTTCAGGACGGAAAGAGTAGGTAGGTAGGAATAAGATTGACAAGGTACCAAGTGACCACCAGCTCGCCA

Reverse complement sequence

TGGCGAGCTGGTGGTCACTTGGTACCTTGTCAATCTTATTCCTACCTACCTACTCTTTCCGTCCTGAAAAGAGATGATTTCTAGCGAGAAGAGTTTGTCC[C/A]
GTAAAAAGGCGACTTCTACACAAAAACAAGAAGCATTCAACCGCTGCTGATTACGAAGTGACTGCTCAATCGGCTCATTAATTAGCATCGATGGGTGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 9.80% 0.72% 27.47% NA
All Indica  2759 75.40% 0.10% 0.72% 23.81% NA
All Japonica  1512 29.80% 29.30% 0.86% 40.08% NA
Aus  269 93.30% 2.60% 0.00% 4.09% NA
Indica I  595 79.50% 0.00% 2.02% 18.49% NA
Indica II  465 62.20% 0.00% 0.43% 37.42% NA
Indica III  913 75.40% 0.00% 0.11% 24.53% NA
Indica Intermediate  786 80.00% 0.40% 0.64% 18.96% NA
Temperate Japonica  767 50.50% 36.50% 1.43% 11.60% NA
Tropical Japonica  504 5.80% 12.30% 0.20% 81.75% NA
Japonica Intermediate  241 14.10% 41.90% 0.41% 43.57% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 64.40% 8.90% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000109717 G -> T LOC_Os10g01120.1 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:83.631; most accessible tissue: Callus, score: 98.324 N N N N
vg1000109717 G -> T LOC_Os10g01134.1 downstream_gene_variant ; 421.0bp to feature; MODIFIER silent_mutation Average:83.631; most accessible tissue: Callus, score: 98.324 N N N N
vg1000109717 G -> T LOC_Os10g01134.2 downstream_gene_variant ; 421.0bp to feature; MODIFIER silent_mutation Average:83.631; most accessible tissue: Callus, score: 98.324 N N N N
vg1000109717 G -> T LOC_Os10g01120-LOC_Os10g01134 intergenic_region ; MODIFIER silent_mutation Average:83.631; most accessible tissue: Callus, score: 98.324 N N N N
vg1000109717 G -> DEL N N silent_mutation Average:83.631; most accessible tissue: Callus, score: 98.324 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1000109717 G T 0.13 0.08 0.06 0.04 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000109717 NA 3.02E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000109717 NA 1.88E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000109717 NA 4.73E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000109717 2.54E-06 NA mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000109717 5.60E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000109717 NA 2.56E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251