Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000105874:

Variant ID: vg1000105874 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 105874
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTCATTTATTCCATAAATAAATCATGACATTGCAAATGACATAATCACATCATACGATCTACACATGTAAACTAGACAGTAAAGTATGAACAGAT[T/C]
GAATATGCGGAATATGTCGAATGCATACCGAGGGTTTTGGAAAACTGGCTGCTCAGCAGGAAGGACTCAGGGTACCGTGCATTGACGATGGCGCGCAACA

Reverse complement sequence

TGTTGCGCGCCATCGTCAATGCACGGTACCCTGAGTCCTTCCTGCTGAGCAGCCAGTTTTCCAAAACCCTCGGTATGCATTCGACATATTCCGCATATTC[A/G]
ATCTGTTCATACTTTACTGTCTAGTTTACATGTGTAGATCGTATGATGTGATTATGTCATTTGCAATGTCATGATTTATTTATGGAATAAATGAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 18.10% 0.02% 0.00% NA
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 46.00% 54.00% 0.00% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 17.50% 82.50% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 12.70% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 49.80% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000105874 T -> C LOC_Os10g01110.1 upstream_gene_variant ; 2433.0bp to feature; MODIFIER silent_mutation Average:75.417; most accessible tissue: Zhenshan97 young leaf, score: 86.22 N N N N
vg1000105874 T -> C LOC_Os10g01134.1 downstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:75.417; most accessible tissue: Zhenshan97 young leaf, score: 86.22 N N N N
vg1000105874 T -> C LOC_Os10g01134.2 downstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:75.417; most accessible tissue: Zhenshan97 young leaf, score: 86.22 N N N N
vg1000105874 T -> C LOC_Os10g01120.1 intron_variant ; MODIFIER silent_mutation Average:75.417; most accessible tissue: Zhenshan97 young leaf, score: 86.22 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000105874 3.11E-06 3.11E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 2.12E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 7.05E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 4.43E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 7.84E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 6.07E-10 4.00E-30 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 1.96E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 4.85E-09 3.94E-44 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 2.82E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 5.56E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 9.46E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 2.21E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 4.76E-10 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 1.74E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 1.06E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 1.39E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 2.40E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 8.26E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 8.30E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 2.50E-11 2.45E-51 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 7.38E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 6.21E-07 2.31E-13 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 2.19E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 9.85E-06 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 6.91E-11 5.49E-43 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 4.27E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 2.41E-07 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 1.58E-06 NA mr1383_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 3.68E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 1.96E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 6.60E-07 2.21E-18 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000105874 NA 2.11E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251