Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000093149:

Variant ID: vg1000093149 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 93149
Reference Allele: A	Alternative Allele: C,AC
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTAAATATTGTAAAAAAAAAGAAACCCAACGAGACAAAAAACTGTAAAAACTATAAGGTCCATTTTTAAAGGTTTGGGCTTCTAAAAAGTAAAAAAAA[A/C,AC]
CCAATGATAATCATGTTTAATTTTAAAATCTCAATGACATTAAAGAAGGGCGGCAACGTGTGAATCGTAGGGGAGGACAATAACAAAGTCGCTGACGTTT

Reverse complement sequence

AAACGTCAGCGACTTTGTTATTGTCCTCCCCTACGATTCACACGTTGCCGCCCTTCTTTAATGTCATTGAGATTTTAAAATTAAACATGATTATCATTGG[T/G,GT]
TTTTTTTTACTTTTTAGAAGCCCAAACCTTTAAAAATGGACCTTATAGTTTTTACAGTTTTTTGTCTCGTTGGGTTTCTTTTTTTTTACAATATTTAGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	33.50%	3.83%	0.00%	AC: 4.51%
All Indica	2759	34.30%	52.80%	5.36%	0.00%	AC: 7.54%
All Japonica	1512	96.40%	1.30%	2.12%	0.00%	AC: 0.26%
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	37.60%	40.80%	9.75%	0.00%	AC: 11.76%
Indica II	465	42.60%	42.20%	5.59%	0.00%	AC: 9.68%
Indica III	913	31.70%	63.20%	1.75%	0.00%	AC: 3.40%
Indica Intermediate	786	29.90%	56.10%	6.11%	0.00%	AC: 7.89%
Temperate Japonica	767	95.30%	0.50%	3.65%	0.00%	AC: 0.52%
Tropical Japonica	504	97.20%	2.40%	0.40%	0.00%	NA
Japonica Intermediate	241	97.90%	1.20%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	24.40%	1.11%	0.00%	AC: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000093149	A -> C	LOC_Os10g01100.1	upstream_gene_variant ; 1649.0bp to feature; MODIFIER	silent_mutation	Average:36.611; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1000093149	A -> C	LOC_Os10g01090-LOC_Os10g01100	intergenic_region ; MODIFIER	silent_mutation	Average:36.611; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1000093149	A -> AC	LOC_Os10g01100.1	upstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:36.611; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1000093149	A -> AC	LOC_Os10g01090-LOC_Os10g01100	intergenic_region ; MODIFIER	silent_mutation	Average:36.611; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000093149	NA	1.58E-06	mr1158	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000093149	NA	4.06E-06	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000093149	6.37E-06	1.38E-07	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000093149	1.36E-06	2.41E-10	mr1158_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000093149	4.19E-06	5.47E-09	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000093149	NA	1.81E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251