\
| Variant ID: vg1000091714 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 91714 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )
ATTTAGGCTCATTTGGTCTGCTCTCTATTTTTATCTATCTATTATATTATTAAAACAGCCTTGAAAGGAGGCACTAAGTTCGCTGTGCGGGCTAGAAATT[C/T]
CCATGTTAATTGGAGAAAAAGAAAAGAAAAGTCCAAGTAAAAATATAATCTAAAAATAGCTGAAATTCGGAATTAAAAGTAAGCAATATTGAAAAAAGAG
CTCTTTTTTCAATATTGCTTACTTTTAATTCCGAATTTCAGCTATTTTTAGATTATATTTTTACTTGGACTTTTCTTTTCTTTTTCTCCAATTAACATGG[G/A]
AATTTCTAGCCCGCACAGCGAACTTAGTGCCTCCTTTCAAGGCTGTTTTAATAATATAATAGATAGATAAAAATAGAGAGCAGACCAAATGAGCCTAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 40.90% | 1.14% | 0.00% | NA |
| All Indica | 2759 | 34.10% | 65.20% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 96.50% | 1.40% | 2.12% | 0.00% | NA |
| Aus | 269 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 37.80% | 61.30% | 0.84% | 0.00% | NA |
| Indica II | 465 | 41.90% | 57.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 31.40% | 68.00% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 29.90% | 69.60% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 0.80% | 3.78% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 28.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000091714 | C -> T | LOC_Os10g01100.1 | upstream_gene_variant ; 3084.0bp to feature; MODIFIER | silent_mutation | Average:32.558; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1000091714 | C -> T | LOC_Os10g01090-LOC_Os10g01100 | intergenic_region ; MODIFIER | silent_mutation | Average:32.558; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000091714 | NA | 2.22E-07 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | NA | 2.41E-07 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | NA | 1.27E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | 3.59E-06 | 3.59E-06 | mr1449 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | NA | 3.36E-06 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | 7.71E-06 | NA | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | 4.78E-07 | 7.89E-09 | mr1158_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | NA | 2.32E-08 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | NA | 1.05E-06 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000091714 | NA | 3.31E-07 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |