Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000091714:

Variant ID: vg1000091714 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 91714
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTAGGCTCATTTGGTCTGCTCTCTATTTTTATCTATCTATTATATTATTAAAACAGCCTTGAAAGGAGGCACTAAGTTCGCTGTGCGGGCTAGAAATT[C/T]
CCATGTTAATTGGAGAAAAAGAAAAGAAAAGTCCAAGTAAAAATATAATCTAAAAATAGCTGAAATTCGGAATTAAAAGTAAGCAATATTGAAAAAAGAG

Reverse complement sequence

CTCTTTTTTCAATATTGCTTACTTTTAATTCCGAATTTCAGCTATTTTTAGATTATATTTTTACTTGGACTTTTCTTTTCTTTTTCTCCAATTAACATGG[G/A]
AATTTCTAGCCCGCACAGCGAACTTAGTGCCTCCTTTCAAGGCTGTTTTAATAATATAATAGATAGATAAAAATAGAGAGCAGACCAAATGAGCCTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	40.90%	1.14%	0.00%	NA
All Indica	2759	34.10%	65.20%	0.69%	0.00%	NA
All Japonica	1512	96.50%	1.40%	2.12%	0.00%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	37.80%	61.30%	0.84%	0.00%	NA
Indica II	465	41.90%	57.00%	1.08%	0.00%	NA
Indica III	913	31.40%	68.00%	0.55%	0.00%	NA
Indica Intermediate	786	29.90%	69.60%	0.51%	0.00%	NA
Temperate Japonica	767	95.40%	0.80%	3.78%	0.00%	NA
Tropical Japonica	504	97.20%	2.60%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	0.80%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000091714	C -> T	LOC_Os10g01100.1	upstream_gene_variant ; 3084.0bp to feature; MODIFIER	silent_mutation	Average:32.558; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1000091714	C -> T	LOC_Os10g01090-LOC_Os10g01100	intergenic_region ; MODIFIER	silent_mutation	Average:32.558; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000091714	NA	2.22E-07	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	NA	2.41E-07	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	NA	1.27E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	3.59E-06	3.59E-06	mr1449	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	NA	3.36E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	7.71E-06	NA	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	4.78E-07	7.89E-09	mr1158_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	NA	2.32E-08	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	NA	1.05E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714	NA	3.31E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251