\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000091714:

Variant ID: vg1000091714 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 91714
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAGGCTCATTTGGTCTGCTCTCTATTTTTATCTATCTATTATATTATTAAAACAGCCTTGAAAGGAGGCACTAAGTTCGCTGTGCGGGCTAGAAATT[C/T]
CCATGTTAATTGGAGAAAAAGAAAAGAAAAGTCCAAGTAAAAATATAATCTAAAAATAGCTGAAATTCGGAATTAAAAGTAAGCAATATTGAAAAAAGAG

Reverse complement sequence

CTCTTTTTTCAATATTGCTTACTTTTAATTCCGAATTTCAGCTATTTTTAGATTATATTTTTACTTGGACTTTTCTTTTCTTTTTCTCCAATTAACATGG[G/A]
AATTTCTAGCCCGCACAGCGAACTTAGTGCCTCCTTTCAAGGCTGTTTTAATAATATAATAGATAGATAAAAATAGAGAGCAGACCAAATGAGCCTAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 40.90% 1.14% 0.00% NA
All Indica  2759 34.10% 65.20% 0.69% 0.00% NA
All Japonica  1512 96.50% 1.40% 2.12% 0.00% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 37.80% 61.30% 0.84% 0.00% NA
Indica II  465 41.90% 57.00% 1.08% 0.00% NA
Indica III  913 31.40% 68.00% 0.55% 0.00% NA
Indica Intermediate  786 29.90% 69.60% 0.51% 0.00% NA
Temperate Japonica  767 95.40% 0.80% 3.78% 0.00% NA
Tropical Japonica  504 97.20% 2.60% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 68.90% 28.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000091714 C -> T LOC_Os10g01100.1 upstream_gene_variant ; 3084.0bp to feature; MODIFIER silent_mutation Average:32.558; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1000091714 C -> T LOC_Os10g01090-LOC_Os10g01100 intergenic_region ; MODIFIER silent_mutation Average:32.558; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000091714 NA 2.22E-07 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 NA 2.41E-07 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 NA 1.27E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 3.59E-06 3.59E-06 mr1449 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 NA 3.36E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 7.71E-06 NA mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 4.78E-07 7.89E-09 mr1158_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 NA 2.32E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 NA 1.05E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000091714 NA 3.31E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251