\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000080430:

Variant ID: vg1000080430 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 80430
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAAAAATAGTTTAAAGTGGTTTTGCACGCATGCATGGCTCTGACGTTATGCTGACGTTAGCGTCCGATTTTTTCATGCTTGGATGGGGCGCCCGATCG[G/A]
TAGTCTCGTCCTATAAAATAATGTATATCTATGTTGATTTCTTCGTAGCATACTTGTTTTGCTTCTAGATCGATTGTGGGCTATCTCCGCCCAATGTCTC

Reverse complement sequence

GAGACATTGGGCGGAGATAGCCCACAATCGATCTAGAAGCAAAACAAGTATGCTACGAAGAAATCAACATAGATATACATTATTTTATAGGACGAGACTA[C/T]
CGATCGGGCGCCCCATCCAAGCATGAAAAAATCGGACGCTAACGTCAGCATAACGTCAGAGCCATGCATGCGTGCAAAACCACTTTAAACTATTTTTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.30% 0.15% 0.00% NA
All Indica  2759 68.70% 31.10% 0.22% 0.00% NA
All Japonica  1512 58.80% 41.20% 0.00% 0.00% NA
Aus  269 40.90% 58.70% 0.37% 0.00% NA
Indica I  595 63.90% 36.00% 0.17% 0.00% NA
Indica II  465 60.00% 39.80% 0.22% 0.00% NA
Indica III  913 72.60% 27.10% 0.33% 0.00% NA
Indica Intermediate  786 73.00% 26.80% 0.13% 0.00% NA
Temperate Japonica  767 87.90% 12.10% 0.00% 0.00% NA
Tropical Japonica  504 16.50% 83.50% 0.00% 0.00% NA
Japonica Intermediate  241 54.80% 45.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000080430 G -> A LOC_Os10g01070.1 upstream_gene_variant ; 4125.0bp to feature; MODIFIER silent_mutation Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1000080430 G -> A LOC_Os10g01080.1 downstream_gene_variant ; 534.0bp to feature; MODIFIER silent_mutation Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1000080430 G -> A LOC_Os10g01090.1 downstream_gene_variant ; 4848.0bp to feature; MODIFIER silent_mutation Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1000080430 G -> A LOC_Os10g01070-LOC_Os10g01080 intergenic_region ; MODIFIER silent_mutation Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000080430 NA 1.72E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 4.94E-06 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 5.07E-06 4.37E-07 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 4.49E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.45E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 5.81E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 7.11E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 2.45E-06 NA mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 2.82E-06 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.03E-06 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 3.97E-06 3.97E-06 mr1449 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 4.51E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 1.80E-07 NA mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 4.65E-08 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 2.34E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 3.19E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 4.20E-07 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 3.33E-06 3.33E-06 mr1520 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 2.53E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.00E-06 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.94E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 8.17E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.67E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 2.67E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 7.20E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 9.69E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 4.39E-10 mr1729 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 9.80E-09 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 6.39E-07 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 5.64E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 4.18E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 3.59E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 2.35E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.65E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 9.05E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 4.25E-06 4.25E-06 mr1981 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 3.01E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 3.40E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 3.50E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.50E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 1.79E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430 NA 8.75E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251