Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000080430:

Variant ID: vg1000080430 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 80430
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAAAATAGTTTAAAGTGGTTTTGCACGCATGCATGGCTCTGACGTTATGCTGACGTTAGCGTCCGATTTTTTCATGCTTGGATGGGGCGCCCGATCG[G/A]
TAGTCTCGTCCTATAAAATAATGTATATCTATGTTGATTTCTTCGTAGCATACTTGTTTTGCTTCTAGATCGATTGTGGGCTATCTCCGCCCAATGTCTC

Reverse complement sequence

GAGACATTGGGCGGAGATAGCCCACAATCGATCTAGAAGCAAAACAAGTATGCTACGAAGAAATCAACATAGATATACATTATTTTATAGGACGAGACTA[C/T]
CGATCGGGCGCCCCATCCAAGCATGAAAAAATCGGACGCTAACGTCAGCATAACGTCAGAGCCATGCATGCGTGCAAAACCACTTTAAACTATTTTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.30%	0.15%	0.00%	NA
All Indica	2759	68.70%	31.10%	0.22%	0.00%	NA
All Japonica	1512	58.80%	41.20%	0.00%	0.00%	NA
Aus	269	40.90%	58.70%	0.37%	0.00%	NA
Indica I	595	63.90%	36.00%	0.17%	0.00%	NA
Indica II	465	60.00%	39.80%	0.22%	0.00%	NA
Indica III	913	72.60%	27.10%	0.33%	0.00%	NA
Indica Intermediate	786	73.00%	26.80%	0.13%	0.00%	NA
Temperate Japonica	767	87.90%	12.10%	0.00%	0.00%	NA
Tropical Japonica	504	16.50%	83.50%	0.00%	0.00%	NA
Japonica Intermediate	241	54.80%	45.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000080430	G -> A	LOC_Os10g01070.1	upstream_gene_variant ; 4125.0bp to feature; MODIFIER	silent_mutation	Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1000080430	G -> A	LOC_Os10g01080.1	downstream_gene_variant ; 534.0bp to feature; MODIFIER	silent_mutation	Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1000080430	G -> A	LOC_Os10g01090.1	downstream_gene_variant ; 4848.0bp to feature; MODIFIER	silent_mutation	Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1000080430	G -> A	LOC_Os10g01070-LOC_Os10g01080	intergenic_region ; MODIFIER	silent_mutation	Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000080430	NA	1.72E-08	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	4.94E-06	mr1158	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	5.07E-06	4.37E-07	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	4.49E-08	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.45E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	5.81E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	7.11E-08	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	2.45E-06	NA	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	2.82E-06	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.03E-06	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	3.97E-06	3.97E-06	mr1449	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	4.51E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	1.80E-07	NA	mr1486	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	4.65E-08	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	2.34E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	3.19E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	4.20E-07	mr1520	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	3.33E-06	3.33E-06	mr1520	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	2.53E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.00E-06	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.94E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	8.17E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.67E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	2.67E-09	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	7.20E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	9.69E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	4.39E-10	mr1729	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	9.80E-09	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	6.39E-07	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	5.64E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	4.18E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	3.59E-07	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	2.35E-07	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.65E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	9.05E-09	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	4.25E-06	4.25E-06	mr1981	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	3.01E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	3.40E-07	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	3.50E-09	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.50E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	1.79E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080430	NA	8.75E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251