| Variant ID: vg1000080430 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 80430 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )
AGAAAAAATAGTTTAAAGTGGTTTTGCACGCATGCATGGCTCTGACGTTATGCTGACGTTAGCGTCCGATTTTTTCATGCTTGGATGGGGCGCCCGATCG[G/A]
TAGTCTCGTCCTATAAAATAATGTATATCTATGTTGATTTCTTCGTAGCATACTTGTTTTGCTTCTAGATCGATTGTGGGCTATCTCCGCCCAATGTCTC
GAGACATTGGGCGGAGATAGCCCACAATCGATCTAGAAGCAAAACAAGTATGCTACGAAGAAATCAACATAGATATACATTATTTTATAGGACGAGACTA[C/T]
CGATCGGGCGCCCCATCCAAGCATGAAAAAATCGGACGCTAACGTCAGCATAACGTCAGAGCCATGCATGCGTGCAAAACCACTTTAAACTATTTTTTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 35.30% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 68.70% | 31.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 58.80% | 41.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.90% | 58.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 63.90% | 36.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 60.00% | 39.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 72.60% | 27.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 73.00% | 26.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 16.50% | 83.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 54.80% | 45.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000080430 | G -> A | LOC_Os10g01070.1 | upstream_gene_variant ; 4125.0bp to feature; MODIFIER | silent_mutation | Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1000080430 | G -> A | LOC_Os10g01080.1 | downstream_gene_variant ; 534.0bp to feature; MODIFIER | silent_mutation | Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1000080430 | G -> A | LOC_Os10g01090.1 | downstream_gene_variant ; 4848.0bp to feature; MODIFIER | silent_mutation | Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1000080430 | G -> A | LOC_Os10g01070-LOC_Os10g01080 | intergenic_region ; MODIFIER | silent_mutation | Average:30.244; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000080430 | NA | 1.72E-08 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | NA | 4.94E-06 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | 5.07E-06 | 4.37E-07 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | NA | 4.49E-08 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | NA | 1.45E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | NA | 5.81E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | NA | 7.11E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | 2.45E-06 | NA | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | NA | 2.82E-06 | mr1350 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000080430 | NA | 1.03E-06 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/