Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000080422:

Variant ID: vg1000080422 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 80422
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTAAGAGAAAAAATAGTTTAAAGTGGTTTTGCACGCATGCATGGCTCTGACGTTATGCTGACGTTAGCGTCCGATTTTTTCATGCTTGGATGGGGCG[C/T]
CCGATCGGTAGTCTCGTCCTATAAAATAATGTATATCTATGTTGATTTCTTCGTAGCATACTTGTTTTGCTTCTAGATCGATTGTGGGCTATCTCCGCCC

Reverse complement sequence

GGGCGGAGATAGCCCACAATCGATCTAGAAGCAAAACAAGTATGCTACGAAGAAATCAACATAGATATACATTATTTTATAGGACGAGACTACCGATCGG[G/A]
CGCCCCATCCAAGCATGAAAAAATCGGACGCTAACGTCAGCATAACGTCAGAGCCATGCATGCGTGCAAAACCACTTTAAACTATTTTTTCTCTTAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.80% 0.15% 0.00% NA
All Indica  2759 70.80% 29.00% 0.22% 0.00% NA
All Japonica  1512 59.00% 40.90% 0.07% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 62.90% 36.60% 0.50% 0.00% NA
Indica II  465 60.40% 39.60% 0.00% 0.00% NA
Indica III  913 75.20% 24.60% 0.11% 0.00% NA
Indica Intermediate  786 77.70% 22.00% 0.25% 0.00% NA
Temperate Japonica  767 87.90% 12.10% 0.00% 0.00% NA
Tropical Japonica  504 16.70% 83.10% 0.20% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000080422 C -> T LOC_Os10g01070.1 upstream_gene_variant ; 4117.0bp to feature; MODIFIER silent_mutation Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1000080422 C -> T LOC_Os10g01080.1 downstream_gene_variant ; 542.0bp to feature; MODIFIER silent_mutation Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1000080422 C -> T LOC_Os10g01090.1 downstream_gene_variant ; 4856.0bp to feature; MODIFIER silent_mutation Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1000080422 C -> T LOC_Os10g01070-LOC_Os10g01080 intergenic_region ; MODIFIER silent_mutation Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000080422 NA 1.32E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 3.17E-07 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 1.99E-07 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 3.17E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 9.86E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 5.28E-06 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 1.08E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 2.54E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 9.36E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 2.82E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 4.63E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 2.13E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 1.00E-06 1.00E-06 mr1981 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 8.14E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 2.03E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 2.00E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 4.42E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 4.29E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 1.08E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422 NA 5.04E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251