Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000080422:

Variant ID: vg1000080422 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 80422
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTAAGAGAAAAAATAGTTTAAAGTGGTTTTGCACGCATGCATGGCTCTGACGTTATGCTGACGTTAGCGTCCGATTTTTTCATGCTTGGATGGGGCG[C/T]
CCGATCGGTAGTCTCGTCCTATAAAATAATGTATATCTATGTTGATTTCTTCGTAGCATACTTGTTTTGCTTCTAGATCGATTGTGGGCTATCTCCGCCC

Reverse complement sequence

GGGCGGAGATAGCCCACAATCGATCTAGAAGCAAAACAAGTATGCTACGAAGAAATCAACATAGATATACATTATTTTATAGGACGAGACTACCGATCGG[G/A]
CGCCCCATCCAAGCATGAAAAAATCGGACGCTAACGTCAGCATAACGTCAGAGCCATGCATGCGTGCAAAACCACTTTAAACTATTTTTTCTCTTAAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	30.80%	0.15%	0.00%	NA
All Indica	2759	70.80%	29.00%	0.22%	0.00%	NA
All Japonica	1512	59.00%	40.90%	0.07%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	62.90%	36.60%	0.50%	0.00%	NA
Indica II	465	60.40%	39.60%	0.00%	0.00%	NA
Indica III	913	75.20%	24.60%	0.11%	0.00%	NA
Indica Intermediate	786	77.70%	22.00%	0.25%	0.00%	NA
Temperate Japonica	767	87.90%	12.10%	0.00%	0.00%	NA
Tropical Japonica	504	16.70%	83.10%	0.20%	0.00%	NA
Japonica Intermediate	241	55.60%	44.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000080422	C -> T	LOC_Os10g01070.1	upstream_gene_variant ; 4117.0bp to feature; MODIFIER	silent_mutation	Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1000080422	C -> T	LOC_Os10g01080.1	downstream_gene_variant ; 542.0bp to feature; MODIFIER	silent_mutation	Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1000080422	C -> T	LOC_Os10g01090.1	downstream_gene_variant ; 4856.0bp to feature; MODIFIER	silent_mutation	Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg1000080422	C -> T	LOC_Os10g01070-LOC_Os10g01080	intergenic_region ; MODIFIER	silent_mutation	Average:27.991; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000080422	NA	1.32E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	3.17E-07	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	1.99E-07	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	3.17E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	9.86E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	5.28E-06	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	1.08E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	2.54E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	9.36E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	2.82E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	4.63E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	2.13E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	1.00E-06	1.00E-06	mr1981	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	8.14E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	2.03E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	2.00E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	4.42E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	4.29E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	1.08E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080422	NA	5.04E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251