\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000080276:

Variant ID: vg1000080276 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 80276
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATTATTTTTATATAAGGTGAAATAACGCCCGATTTAATAATAAGCTAAAAAAATTTCGCCGGAATATATCCATGTGTGGTCTTGTTTTGAATATTTA[A/T]
TTGCAACGAATTTAATGATGTAATCGGATCATGATTTGGATAAATAATTTAAGAGAAAAAATAGTTTAAAGTGGTTTTGCACGCATGCATGGCTCTGACG

Reverse complement sequence

CGTCAGAGCCATGCATGCGTGCAAAACCACTTTAAACTATTTTTTCTCTTAAATTATTTATCCAAATCATGATCCGATTACATCATTAAATTCGTTGCAA[T/A]
TAAATATTCAAAACAAGACCACACATGGATATATTCCGGCGAAATTTTTTTAGCTTATTATTAAATCGGGCGTTATTTCACCTTATATAAAAATAATACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 35.30% 0.34% 0.00% NA
All Indica  2759 68.50% 31.10% 0.40% 0.00% NA
All Japonica  1512 58.70% 41.00% 0.26% 0.00% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 63.70% 35.80% 0.50% 0.00% NA
Indica II  465 59.60% 40.00% 0.43% 0.00% NA
Indica III  913 72.90% 26.70% 0.33% 0.00% NA
Indica Intermediate  786 72.40% 27.20% 0.38% 0.00% NA
Temperate Japonica  767 88.00% 12.00% 0.00% 0.00% NA
Tropical Japonica  504 16.70% 83.10% 0.20% 0.00% NA
Japonica Intermediate  241 53.50% 45.20% 1.24% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000080276 A -> T LOC_Os10g01070.1 upstream_gene_variant ; 3971.0bp to feature; MODIFIER silent_mutation Average:34.695; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1000080276 A -> T LOC_Os10g01080.1 downstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:34.695; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1000080276 A -> T LOC_Os10g01070-LOC_Os10g01080 intergenic_region ; MODIFIER silent_mutation Average:34.695; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000080276 2.04E-06 2.04E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 2.33E-06 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 7.76E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 8.54E-07 3.23E-08 mr1168 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 5.45E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 5.51E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 5.29E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 1.74E-06 6.35E-08 mr1383 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 8.71E-07 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 9.31E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 2.82E-06 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 2.59E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 1.25E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 2.28E-06 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 1.86E-07 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 4.25E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 8.35E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 4.81E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 1.34E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000080276 NA 6.75E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251