\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000079710:

Variant ID: vg1000079710 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 79710
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATCTCGTCAAATGTTTTAGATGGTCTTGTACATGCATAGATCATACTGGCGAAGATATTGTACCTTAAATTTTATTTGCCATGTCTTATAAAATAC[A/G]
AATATGCTTAGGCCAGGGCGACCGACGGGGGTGGAGCAGGATCGAGCGCTCCCCCCCTCCCCGTGCGCACGTTCCCCTGGCCCCACCACGTGTCTCAAAA

Reverse complement sequence

TTTTGAGACACGTGGTGGGGCCAGGGGAACGTGCGCACGGGGAGGGGGGGAGCGCTCGATCCTGCTCCACCCCCGTCGGTCGCCCTGGCCTAAGCATATT[T/C]
GTATTTTATAAGACATGGCAAATAAAATTTAAGGTACAATATCTTCGCCAGTATGATCTATGCATGTACAAGACCATCTAAAACATTTGACGAGATAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.80% 1.70% 13.61% 65.83% NA
All Indica  2759 0.90% 2.20% 10.84% 86.01% NA
All Japonica  1512 54.90% 0.40% 3.97% 40.74% NA
Aus  269 2.60% 1.50% 67.66% 28.25% NA
Indica I  595 0.80% 1.70% 7.23% 90.25% NA
Indica II  465 0.90% 2.60% 8.60% 87.96% NA
Indica III  913 0.20% 1.50% 12.92% 85.32% NA
Indica Intermediate  786 1.90% 3.20% 12.47% 82.44% NA
Temperate Japonica  767 84.00% 0.10% 4.69% 11.21% NA
Tropical Japonica  504 12.90% 1.00% 2.38% 83.73% NA
Japonica Intermediate  241 50.20% 0.00% 4.98% 44.81% NA
VI/Aromatic  96 9.40% 6.20% 82.29% 2.08% NA
Intermediate  90 20.00% 5.60% 25.56% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000079710 A -> G LOC_Os10g01070.1 upstream_gene_variant ; 3405.0bp to feature; MODIFIER silent_mutation Average:36.957; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg1000079710 A -> G LOC_Os10g01080.1 downstream_gene_variant ; 1254.0bp to feature; MODIFIER silent_mutation Average:36.957; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg1000079710 A -> G LOC_Os10g01070-LOC_Os10g01080 intergenic_region ; MODIFIER silent_mutation Average:36.957; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg1000079710 A -> DEL N N silent_mutation Average:36.957; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000079710 1.82E-06 1.82E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 6.43E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 3.47E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 5.28E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 8.34E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 4.98E-13 5.82E-34 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 2.63E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 5.93E-13 1.28E-49 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 4.35E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 7.62E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 1.43E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 2.06E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 2.38E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 4.03E-11 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 3.20E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 1.52E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 3.18E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 9.61E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 3.40E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 9.27E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 1.09E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 7.34E-16 3.77E-58 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 3.84E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 3.91E-08 7.10E-15 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 9.94E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 5.93E-19 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 7.22E-07 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 3.71E-14 1.26E-47 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 2.52E-11 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 2.74E-08 NA mr1383_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 1.07E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 3.22E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 2.20E-08 6.50E-21 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000079710 NA 4.89E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251