\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000073755:

Variant ID: vg1000073755 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 73755
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.24, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATATAATAGTTACCTATAAATATATACTACACAAGTCATAGTTGGTCCCACCTGTCATTTACATTTGCATCTTGAAGTCTGTGCCGCAGCTGGCTA[T/C]
AAATTTGTAGCCCGCTACTCTTCTCTCTCCTGTTTTATATTCTCGAAATATGTTTATAGCTGTCTTATAGTCTGCTATTGTACTGCTCTTAAGGCAAGAT

Reverse complement sequence

ATCTTGCCTTAAGAGCAGTACAATAGCAGACTATAAGACAGCTATAAACATATTTCGAGAATATAAAACAGGAGAGAGAAGAGTAGCGGGCTACAAATTT[A/G]
TAGCCAGCTGCGGCACAGACTTCAAGATGCAAATGTAAATGACAGGTGGGACCAACTATGACTTGTGTAGTATATATTTATAGGTAACTATTATATAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 45.00% 0.53% 0.06% NA
All Indica  2759 32.20% 67.10% 0.62% 0.07% NA
All Japonica  1512 96.00% 3.60% 0.33% 0.07% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 37.30% 61.70% 0.84% 0.17% NA
Indica II  465 41.50% 57.60% 0.65% 0.22% NA
Indica III  913 27.50% 72.20% 0.33% 0.00% NA
Indica Intermediate  786 28.20% 71.00% 0.76% 0.00% NA
Temperate Japonica  767 95.70% 4.00% 0.26% 0.00% NA
Tropical Japonica  504 96.60% 3.20% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 3.30% 0.83% 0.41% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000073755 T -> C LOC_Os10g01060.1 downstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:60.081; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg1000073755 T -> C LOC_Os10g01070.1 downstream_gene_variant ; 1655.0bp to feature; MODIFIER silent_mutation Average:60.081; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg1000073755 T -> C LOC_Os10g01060-LOC_Os10g01070 intergenic_region ; MODIFIER silent_mutation Average:60.081; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg1000073755 T -> DEL N N silent_mutation Average:60.081; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000073755 3.46E-07 NA mr1168 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 7.03E-06 1.90E-07 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 4.90E-07 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 4.49E-06 1.23E-07 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 NA 1.76E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 8.60E-06 8.60E-06 mr1449 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 NA 3.18E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 2.49E-06 2.41E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 4.05E-06 8.00E-08 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 1.79E-08 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 NA 1.56E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 8.42E-07 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 NA 7.22E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000073755 NA 3.70E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251