Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000060841:

Variant ID: vg1000060841 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 60841
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.07, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTATGATAGAAAATAAGTATGTACGTAAAGTACACCACGTACATACAGTTCACGGGGGAAAAACGTTATAGCCCAAAACCCAAAACAAACTTACCTAC[G/T]
TATAGTATGATGGAAAAAATATACAGTACAAACAACATACGTAGTGGAAACCTGAAAATCACCATTGGATCAAAAATGAACGCATGAGATTTGTCCACAT

Reverse complement sequence

ATGTGGACAAATCTCATGCGTTCATTTTTGATCCAATGGTGATTTTCAGGTTTCCACTACGTATGTTGTTTGTACTGTATATTTTTTCCATCATACTATA[C/A]
GTAGGTAAGTTTGTTTTGGGTTTTGGGCTATAACGTTTTTCCCCCGTGAACTGTATGTACGTGGTGTACTTTACGTACATACTTATTTTCTATCATACAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.20%	17.80%	7.66%	15.34%	NA
All Indica	2759	34.80%	27.60%	12.43%	25.19%	NA
All Japonica	1512	98.30%	0.90%	0.33%	0.46%	NA
Aus	269	69.50%	19.00%	4.83%	6.69%	NA
Indica I	595	38.50%	24.40%	15.63%	21.51%	NA
Indica II	465	42.60%	23.90%	11.61%	21.94%	NA
Indica III	913	32.20%	29.90%	7.89%	30.01%	NA
Indica Intermediate	786	30.40%	29.50%	15.78%	24.30%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	97.00%	1.40%	0.40%	1.19%	NA
Japonica Intermediate	241	97.90%	0.40%	1.24%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	17.80%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000060841	G -> T	LOC_Os10g01044.1	upstream_gene_variant ; 2504.0bp to feature; MODIFIER	silent_mutation	Average:52.394; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg1000060841	G -> T	LOC_Os10g01044.2	upstream_gene_variant ; 2504.0bp to feature; MODIFIER	silent_mutation	Average:52.394; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg1000060841	G -> T	LOC_Os10g01044.3	upstream_gene_variant ; 2503.0bp to feature; MODIFIER	silent_mutation	Average:52.394; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg1000060841	G -> T	LOC_Os10g01044-LOC_Os10g01060	intergenic_region ; MODIFIER	silent_mutation	Average:52.394; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg1000060841	G -> DEL	N	N	silent_mutation	Average:52.394; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000060841	NA	3.70E-07	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	4.06E-06	1.31E-07	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	NA	6.54E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	NA	3.04E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	9.46E-06	NA	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	6.34E-07	3.79E-08	mr1158_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	NA	3.12E-08	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	NA	5.46E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000060841	NA	6.38E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251