Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000046107:

Variant ID: vg1000046107 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 46107
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGCACAAACATTGTAAGACTTAGAGAGAATTAATTTGTTGACTTCCAATTCCAATACTACTCTTTGTTTTTTTTGAATTTGGACATGAAAAATACAA[G/C,T]
TCGCTTTTCCTGGATGAAGGTAATTAACTAGTAGTGGATAACTGGATCTTGAGTGATGATTGGCCAAGGCAAAAAACGAATATAGCCTTATATGCTAACT

Reverse complement sequence

AGTTAGCATATAAGGCTATATTCGTTTTTTGCCTTGGCCAATCATCACTCAAGATCCAGTTATCCACTACTAGTTAATTACCTTCATCCAGGAAAAGCGA[C/G,A]
TTGTATTTTTCATGTCCAAATTCAAAAAAAACAAAGAGTAGTATTGGAATTGGAAGTCAACAAATTAATTCTCTCTAAGTCTTACAATGTTTGTGCACCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 13.90% 0.21% 0.00% T: 0.11%
All Indica  2759 98.60% 1.00% 0.29% 0.00% T: 0.18%
All Japonica  1512 60.00% 39.90% 0.07% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 97.10% 1.80% 1.01% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.00% 0.50% 0.00% 0.00% T: 0.44%
Indica Intermediate  786 98.60% 1.10% 0.13% 0.00% T: 0.13%
Temperate Japonica  767 88.40% 11.50% 0.13% 0.00% NA
Tropical Japonica  504 17.90% 82.10% 0.00% 0.00% NA
Japonica Intermediate  241 57.70% 42.30% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000046107 G -> C LOC_Os10g01044.1 3_prime_UTR_variant ; 110.0bp to feature; MODIFIER silent_mutation Average:59.83; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg1000046107 G -> C LOC_Os10g01044.2 3_prime_UTR_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:59.83; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg1000046107 G -> C LOC_Os10g01044.3 3_prime_UTR_variant ; 110.0bp to feature; MODIFIER silent_mutation Average:59.83; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg1000046107 G -> T LOC_Os10g01044.1 3_prime_UTR_variant ; 110.0bp to feature; MODIFIER silent_mutation Average:59.83; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg1000046107 G -> T LOC_Os10g01044.2 3_prime_UTR_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:59.83; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg1000046107 G -> T LOC_Os10g01044.3 3_prime_UTR_variant ; 110.0bp to feature; MODIFIER silent_mutation Average:59.83; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000046107 NA 2.13E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1000046107 NA 3.41E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 8.53E-07 8.52E-07 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 4.35E-09 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.52E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.53E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 7.78E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 2.06E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 3.69E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.44E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 7.44E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.10E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 8.68E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 7.20E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 5.48E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 3.65E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.97E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 3.78E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 3.54E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.16E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.95E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 6.77E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.43E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 9.34E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.12E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 3.88E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 3.00E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 6.72E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.99E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.99E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.87E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 8.11E-06 NA mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.75E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 2.83E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 1.11E-06 1.11E-06 mr1981 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 5.92E-07 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.48E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 1.09E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 7.08E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.99E-19 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000046107 NA 1.05E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251