\
| Variant ID: vg1000025722 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 25722 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCAGGAGCTAAGCAAATTATTACCAGTCATAACATCAATAATTATTGTGAGAGGTGTGAGACTAATCACGAAAAACATTGCTCAACCCGCCCATAACCGC[G/A,T]
GGCACAGCTATCCGAATAGTTTTACTCTGGCCAGAGGTGTACCACTGTACCCACAAGACACAGCCCCACGACATGTCACCATGCGCCTCAATACCACCAC
GTGGTGGTATTGAGGCGCATGGTGACATGTCGTGGGGCTGTGTCTTGTGGGTACAGTGGTACACCTCTGGCCAGAGTAAAACTATTCGGATAGCTGTGCC[C/T,A]
GCGGTTATGGGCGGGTTGAGCAATGTTTTTCGTGATTAGTCTCACACCTCTCACAATAATTATTGATGTTATGACTGGTAATAATTTGCTTAGCTCCTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.90% | 1.00% | 27.32% | 50.51% | T: 0.30% |
| All Indica | 2759 | 4.70% | 0.00% | 35.81% | 59.01% | T: 0.51% |
| All Japonica | 1512 | 52.50% | 2.80% | 7.74% | 36.97% | NA |
| Aus | 269 | 4.50% | 0.00% | 49.44% | 46.10% | NA |
| Indica I | 595 | 3.20% | 0.00% | 17.65% | 79.16% | NA |
| Indica II | 465 | 4.50% | 0.00% | 31.61% | 63.01% | T: 0.86% |
| Indica III | 913 | 5.60% | 0.00% | 50.93% | 42.83% | T: 0.66% |
| Indica Intermediate | 786 | 4.80% | 0.00% | 34.48% | 60.18% | T: 0.51% |
| Temperate Japonica | 767 | 78.50% | 5.10% | 4.17% | 12.26% | NA |
| Tropical Japonica | 504 | 14.50% | 0.00% | 14.29% | 71.23% | NA |
| Japonica Intermediate | 241 | 49.40% | 1.20% | 5.39% | 43.98% | NA |
| VI/Aromatic | 96 | 25.00% | 4.20% | 32.29% | 38.54% | NA |
| Intermediate | 90 | 32.20% | 0.00% | 24.44% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000025722 | G -> T | LOC_Os10g01010.1 | upstream_gene_variant ; 3146.0bp to feature; MODIFIER | silent_mutation | Average:11.714; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1000025722 | G -> T | LOC_Os10g01020.1 | downstream_gene_variant ; 2967.0bp to feature; MODIFIER | silent_mutation | Average:11.714; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1000025722 | G -> T | LOC_Os10g01010-LOC_Os10g01020 | intergenic_region ; MODIFIER | silent_mutation | Average:11.714; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1000025722 | G -> A | LOC_Os10g01010.1 | upstream_gene_variant ; 3146.0bp to feature; MODIFIER | silent_mutation | Average:11.714; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1000025722 | G -> A | LOC_Os10g01020.1 | downstream_gene_variant ; 2967.0bp to feature; MODIFIER | silent_mutation | Average:11.714; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1000025722 | G -> A | LOC_Os10g01010-LOC_Os10g01020 | intergenic_region ; MODIFIER | silent_mutation | Average:11.714; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg1000025722 | G -> DEL | N | N | silent_mutation | Average:11.714; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000025722 | 2.81E-06 | 2.70E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1000025722 | 3.51E-06 | 3.51E-06 | mr1267 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000025722 | 2.03E-06 | 2.03E-06 | mr1470 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |