\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922661467:

Variant ID: vg0922661467 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22661467
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAATTACACGAGTTCATGCTGCAAAAAACCTGTAGAATTTTTTTTTCTATTTAGACTGAGAAAACTGCAAGTTGATATTTTTAATTCGTCTAATTTGT[G/A]
TTGTTCTTTTAATTCATTTCATGGATTTTTTTATTTGTTTTTGGCGACTAATTAAGATATAGTGGTACTTAATTATGCATGTGATGTACAATAGTAGCTT

Reverse complement sequence

AAGCTACTATTGTACATCACATGCATAATTAAGTACCACTATATCTTAATTAGTCGCCAAAAACAAATAAAAAAATCCATGAAATGAATTAAAAGAACAA[C/T]
ACAAATTAGACGAATTAAAAATATCAACTTGCAGTTTTCTCAGTCTAAATAGAAAAAAAAATTCTACAGGTTTTTTGCAGCATGAACTCGTGTAATTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 22.40% 3.89% 0.00% NA
All Indica  2759 57.10% 36.50% 6.42% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 87.00% 12.60% 0.37% 0.00% NA
Indica I  595 47.40% 39.50% 13.11% 0.00% NA
Indica II  465 35.30% 57.40% 7.31% 0.00% NA
Indica III  913 68.10% 30.80% 1.10% 0.00% NA
Indica Intermediate  786 64.50% 28.50% 7.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 83.30% 10.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922661467 G -> A LOC_Os09g39420.1 upstream_gene_variant ; 4839.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922661467 G -> A LOC_Os09g39400.1 downstream_gene_variant ; 4421.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922661467 G -> A LOC_Os09g39400.2 downstream_gene_variant ; 4421.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922661467 G -> A LOC_Os09g39410.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922661467 6.90E-07 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922661467 2.57E-06 7.84E-08 mr1865 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922661467 1.42E-06 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922661467 1.26E-06 3.00E-07 mr1865_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251