\
| Variant ID: vg0922636537 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22636537 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTCATTGAAACATTTTTTTCTGAGGGATGAAACATGTGAAACATTCCTCGATAACATGGTGCAACATCGTCCGGCGATTTGCACCAGATCGGACATCC[G/A]
ATCCATAGCAGCCTCCGGTTTATCTGCTATCTATCTGCACATGTACAATAAATAGAAGAGAAGAGCTTCAATCGCAATCGGAATCGGAATCGAGTCCGAG
CTCGGACTCGATTCCGATTCCGATTGCGATTGAAGCTCTTCTCTTCTATTTATTGTACATGTGCAGATAGATAGCAGATAAACCGGAGGCTGCTATGGAT[C/T]
GGATGTCCGATCTGGTGCAAATCGCCGGACGATGTTGCACCATGTTATCGAGGAATGTTTCACATGTTTCATCCCTCAGAAAAAAATGTTTCAATGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 10.00% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 82.00% | 16.90% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.70% | 34.50% | 2.86% | 0.00% | NA |
| Indica II | 465 | 63.40% | 35.70% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 12.10% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922636537 | G -> A | LOC_Os09g39360.1 | 5_prime_UTR_variant ; 742.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922636537 | G -> A | LOC_Os09g39350.1 | upstream_gene_variant ; 3042.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922636537 | G -> A | LOC_Os09g39350.2 | upstream_gene_variant ; 3042.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922636537 | G -> A | LOC_Os09g39370.1 | downstream_gene_variant ; 2075.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922636537 | NA | 1.28E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922636537 | 5.13E-10 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922636537 | 4.17E-09 | 2.80E-10 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922636537 | NA | 2.40E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922636537 | 6.37E-11 | NA | mr1865_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922636537 | 2.27E-10 | 3.65E-10 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |