\
| Variant ID: vg0922634062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22634062 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )
TATTTTTGTCCATCGTCGTGTCGGTTTATTTCCCACACGACGCAGCCGCGCTCACTCAGCCAATCTACGCATTCGCTTACAGACATACGCATGCCCAGCT[G/A]
ACCATCTGCCCCTTACGGCTTGTTTGGCAACTTAAGGGAAGGGGATTGGGAGTTTACACGAGGGAATTGATGGTGAGATTAAGATGGGAATTTGATTTTT
AAAAATCAAATTCCCATCTTAATCTCACCATCAATTCCCTCGTGTAAACTCCCAATCCCCTTCCCTTAAGTTGCCAAACAAGCCGTAAGGGGCAGATGGT[C/T]
AGCTGGGCATGCGTATGTCTGTAAGCGAATGCGTAGATTGGCTGAGTGAGCGCGGCTGCGTCGTGTGGGAAATAAACCGACACGACGATGGACAAAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 46.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 23.20% | 76.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 33.60% | 66.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 28.40% | 71.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922634062 | G -> A | LOC_Os09g39350.1 | upstream_gene_variant ; 567.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922634062 | G -> A | LOC_Os09g39360.1 | upstream_gene_variant ; 1416.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922634062 | G -> A | LOC_Os09g39350.2 | upstream_gene_variant ; 567.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922634062 | G -> A | LOC_Os09g39370.1 | downstream_gene_variant ; 4550.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922634062 | G -> A | LOC_Os09g39350-LOC_Os09g39360 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922634062 | 3.15E-15 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922634062 | 8.18E-15 | 9.87E-18 | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922634062 | 1.64E-09 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922634062 | 5.15E-10 | 1.41E-12 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |