\
| Variant ID: vg0922518114 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22518114 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 204. )
TATTGACAAAGAGAATATATTTGAGTAGAGAAACAACTAATCTAATTGTATATTTATTCATTATGTTGATACTTGTTTTTTTTCAATTGTACGGTAAATA[A/G]
GTTATATTTTTTTTCTTATCTAGCTTCACAAACTCCATGACAAAAATAACAGTGTATCCAATTATACTCTTGATATAAGATGGTTTGATACTACTCGGAC
GTCCGAGTAGTATCAAACCATCTTATATCAAGAGTATAATTGGATACACTGTTATTTTTGTCATGGAGTTTGTGAAGCTAGATAAGAAAAAAAATATAAC[T/C]
TATTTACCGTACAATTGAAAAAAAACAAGTATCAACATAATGAATAAATATACAATTAGATTAGTTGTTTCTCTACTCAAATATATTCTCTTTGTCAATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 48.20% | 0.25% | 0.13% | NA |
| All Indica | 2759 | 20.80% | 78.60% | 0.43% | 0.22% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 34.80% | 63.50% | 1.18% | 0.50% | NA |
| Indica II | 465 | 10.30% | 89.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 13.30% | 86.40% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 25.10% | 74.40% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922518114 | A -> G | LOC_Os09g39190.1 | upstream_gene_variant ; 4825.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922518114 | A -> G | LOC_Os09g39200.1 | upstream_gene_variant ; 913.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922518114 | A -> G | LOC_Os09g39190.2 | upstream_gene_variant ; 4825.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922518114 | A -> G | LOC_Os09g39200-LOC_Os09g39220 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922518114 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922518114 | 8.84E-19 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | 9.73E-18 | 2.15E-18 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | NA | 7.01E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | NA | 2.27E-06 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | NA | 1.80E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | NA | 4.21E-10 | mr1527_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | 6.42E-16 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | 4.36E-15 | 8.16E-17 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922518114 | NA | 3.96E-06 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |