Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922518114:

Variant ID: vg0922518114 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22518114
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TATTGACAAAGAGAATATATTTGAGTAGAGAAACAACTAATCTAATTGTATATTTATTCATTATGTTGATACTTGTTTTTTTTCAATTGTACGGTAAATA[A/G]
GTTATATTTTTTTTCTTATCTAGCTTCACAAACTCCATGACAAAAATAACAGTGTATCCAATTATACTCTTGATATAAGATGGTTTGATACTACTCGGAC

Reverse complement sequence

GTCCGAGTAGTATCAAACCATCTTATATCAAGAGTATAATTGGATACACTGTTATTTTTGTCATGGAGTTTGTGAAGCTAGATAAGAAAAAAAATATAAC[T/C]
TATTTACCGTACAATTGAAAAAAAACAAGTATCAACATAATGAATAAATATACAATTAGATTAGTTGTTTCTCTACTCAAATATATTCTCTTTGTCAATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.40%	48.20%	0.25%	0.13%	NA
All Indica	2759	20.80%	78.60%	0.43%	0.22%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	71.00%	29.00%	0.00%	0.00%	NA
Indica I	595	34.80%	63.50%	1.18%	0.50%	NA
Indica II	465	10.30%	89.50%	0.00%	0.22%	NA
Indica III	913	13.30%	86.40%	0.22%	0.11%	NA
Indica Intermediate	786	25.10%	74.40%	0.38%	0.13%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922518114	A -> G	LOC_Os09g39190.1	upstream_gene_variant ; 4825.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922518114	A -> G	LOC_Os09g39200.1	upstream_gene_variant ; 913.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922518114	A -> G	LOC_Os09g39190.2	upstream_gene_variant ; 4825.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922518114	A -> G	LOC_Os09g39200-LOC_Os09g39220	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922518114	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922518114	8.84E-19	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	9.73E-18	2.15E-18	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	NA	7.01E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	NA	2.27E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	NA	1.80E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	NA	4.21E-10	mr1527_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	6.42E-16	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	4.36E-15	8.16E-17	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114	NA	3.96E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251