\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922518114:

Variant ID: vg0922518114 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22518114
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGACAAAGAGAATATATTTGAGTAGAGAAACAACTAATCTAATTGTATATTTATTCATTATGTTGATACTTGTTTTTTTTCAATTGTACGGTAAATA[A/G]
GTTATATTTTTTTTCTTATCTAGCTTCACAAACTCCATGACAAAAATAACAGTGTATCCAATTATACTCTTGATATAAGATGGTTTGATACTACTCGGAC

Reverse complement sequence

GTCCGAGTAGTATCAAACCATCTTATATCAAGAGTATAATTGGATACACTGTTATTTTTGTCATGGAGTTTGTGAAGCTAGATAAGAAAAAAAATATAAC[T/C]
TATTTACCGTACAATTGAAAAAAAACAAGTATCAACATAATGAATAAATATACAATTAGATTAGTTGTTTCTCTACTCAAATATATTCTCTTTGTCAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 48.20% 0.25% 0.13% NA
All Indica  2759 20.80% 78.60% 0.43% 0.22% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 34.80% 63.50% 1.18% 0.50% NA
Indica II  465 10.30% 89.50% 0.00% 0.22% NA
Indica III  913 13.30% 86.40% 0.22% 0.11% NA
Indica Intermediate  786 25.10% 74.40% 0.38% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922518114 A -> G LOC_Os09g39190.1 upstream_gene_variant ; 4825.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922518114 A -> G LOC_Os09g39200.1 upstream_gene_variant ; 913.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922518114 A -> G LOC_Os09g39190.2 upstream_gene_variant ; 4825.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922518114 A -> G LOC_Os09g39200-LOC_Os09g39220 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922518114 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922518114 8.84E-19 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 9.73E-18 2.15E-18 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 NA 7.01E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 NA 2.27E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 NA 1.80E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 NA 4.21E-10 mr1527_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 6.42E-16 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 4.36E-15 8.16E-17 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922518114 NA 3.96E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251