\
| Variant ID: vg0922500002 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22500002 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.35, others allele: 0.00, population size: 82. )
TTTTTCACAGATGAAGTTTCTTAAAAAAAAATTAAATAAATCGAATAAATTTGTTTCTAAAATTTATAATAGCTAATAGTTAATTAATCTTGTGCTAACG[G/A]
CTCATCTCGTATTCTTGTTTTTTTAAAAAAAAAAGCTCAATCCTCACAAAAGTAATTATTATTTTTTTTCCTATCATTTGATTCATTGTTAAATATACTT
AAGTATATTTAACAATGAATCAAATGATAGGAAAAAAAATAATAATTACTTTTGTGAGGATTGAGCTTTTTTTTTTAAAAAAACAAGAATACGAGATGAG[C/T]
CGTTAGCACAAGATTAATTAACTATTAGCTATTATAAATTTTAGAAACAAATTTATTCGATTTATTTAATTTTTTTTTAAGAAACTTCATCTGTGAAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 46.70% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 80.10% | 19.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 0.60% | 99.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.10% | 32.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 90.50% | 8.60% | 0.86% | 0.00% | NA |
| Indica III | 913 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.00% | 20.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 65.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922500002 | G -> A | LOC_Os09g39170-LOC_Os09g39180 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922500002 | NA | 5.02E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | NA | 6.04E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | 5.25E-23 | 5.67E-85 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | 2.23E-22 | 4.87E-24 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | NA | 6.01E-07 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | NA | 3.66E-07 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | NA | 2.91E-13 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | 1.19E-23 | 1.22E-96 | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | 5.57E-24 | 5.64E-27 | mr1865_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | NA | 3.57E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922500002 | NA | 1.69E-07 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |