\
| Variant ID: vg0922498959 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 22498959 |
| Reference Allele: G | Alternative Allele: C,GGC |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAACTTTGCGCTGAACTAAACACAGTCTAAGGATAGGTATCTCTTGCGGATAGATTTCAAAACCTATGGACGATATGGTAATATAGATCTCTAAACTGTT[G/C,GGC]
TTACAAAGTTGCTCTTGGTTGTACCTGCTTTTAATTGAGTACGGTACGGTATATATGTTGGGTTCGCATTATTTGGTCGCCATTTAATTTGCAGTCAAAA
TTTTGACTGCAAATTAAATGGCGACCAAATAATGCGAACCCAACATATATACCGTACCGTACTCAATTAAAAGCAGGTACAACCAAGAGCAACTTTGTAA[C/G,GCC]
AACAGTTTAGAGATCTATATTACCATATCGTCCATAGGTTTTGAAATCTATCCGCAAGAGATACCTATCCTTAGACTGTGTTTAGTTCAGCGCAAAGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 36.60% | 0.04% | 0.00% | GGC: 0.06% |
| All Indica | 2759 | 40.30% | 59.60% | 0.07% | 0.00% | GGC: 0.11% |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 33.60% | 66.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 26.50% | 73.10% | 0.00% | 0.00% | GGC: 0.43% |
| Indica III | 913 | 49.60% | 50.10% | 0.22% | 0.00% | GGC: 0.11% |
| Indica Intermediate | 786 | 42.60% | 57.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922498959 | G -> C | LOC_Os09g39170.1 | upstream_gene_variant ; 4639.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922498959 | G -> C | LOC_Os09g39170-LOC_Os09g39180 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922498959 | G -> GGC | LOC_Os09g39170.1 | upstream_gene_variant ; 4640.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922498959 | G -> GGC | LOC_Os09g39170-LOC_Os09g39180 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922498959 | 3.01E-19 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922498959 | 1.38E-18 | 3.94E-21 | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922498959 | NA | 1.88E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922498959 | 4.99E-18 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922498959 | 3.04E-17 | 8.32E-22 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922498959 | NA | 3.14E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |