Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922495667:

Variant ID: vg0922495667 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22495667
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTCGATAGGTTAAATCTACATTCATCTTTGATTTGGATTTTCTTTTTAGTCTAGATAGATACTCACTTCTTCTCATATTGATCATCATATAAGAAAAT[G/A]
CACCAAGACTAAGAGCAAGTATAATAGTGAGCTATAAGCCTACTATAAGCTTATGTGGAGGAGAGAGATAACAAAAAATCATGGACGTTGGCTCTCAGAG

Reverse complement sequence

CTCTGAGAGCCAACGTCCATGATTTTTTGTTATCTCTCTCCTCCACATAAGCTTATAGTAGGCTTATAGCTCACTATTATACTTGCTCTTAGTCTTGGTG[C/T]
ATTTTCTTATATGATGATCAATATGAGAAGAAGTGAGTATCTATCTAGACTAAAAAGAAAATCCAAATCAAAGATGAATGTAGATTTAACCTATCGACGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.10%	10.70%	2.20%	49.05%	NA
All Indica	2759	4.80%	18.00%	2.86%	74.37%	NA
All Japonica	1512	99.50%	0.00%	0.00%	0.46%	NA
Aus	269	8.60%	0.70%	8.18%	82.53%	NA
Indica I	595	4.90%	31.60%	3.36%	60.17%	NA
Indica II	465	6.50%	6.50%	5.38%	81.72%	NA
Indica III	913	2.20%	15.20%	1.53%	81.05%	NA
Indica Intermediate	786	6.70%	17.70%	2.54%	73.03%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	88.50%	0.00%	2.08%	9.38%	NA
Intermediate	90	61.10%	6.70%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922495667	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922495667	G -> A	LOC_Os09g39170.1	upstream_gene_variant ; 1347.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922495667	G -> A	LOC_Os09g39170-LOC_Os09g39180	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922495667	1.01E-07	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495667	8.57E-09	2.49E-11	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495667	1.84E-06	NA	mr1520_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495667	3.72E-06	9.41E-08	mr1520_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495667	6.67E-06	3.09E-10	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495667	NA	9.86E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251