\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922495561:

Variant ID: vg0922495561 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22495561
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATTAAAGTTGGGCACGAAAATTATGGTTGCACTTAAAATGGAACGAAGGGAGCAGCATTAACTATATTTAGTGAGGATGAACTTTATAGATATATAG[A/G]
ATGCCTCGTCGATAGGTTAAATCTACATTCATCTTTGATTTGGATTTTCTTTTTAGTCTAGATAGATACTCACTTCTTCTCATATTGATCATCATATAAG

Reverse complement sequence

CTTATATGATGATCAATATGAGAAGAAGTGAGTATCTATCTAGACTAAAAAGAAAATCCAAATCAAAGATGAATGTAGATTTAACCTATCGACGAGGCAT[T/C]
CTATATATCTATAAAGTTCATCCTCACTAAATATAGTTAATGCTGCTCCCTTCGTTCCATTTTAAGTGCAACCATAATTTTCGTGCCCAACTTTAATTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.70% 11.40% 1.08% 50.80% NA
All Indica  2759 3.10% 18.60% 1.09% 77.27% NA
All Japonica  1512 99.30% 0.10% 0.00% 0.60% NA
Aus  269 3.00% 7.10% 7.06% 82.90% NA
Indica I  595 4.50% 31.60% 1.01% 62.86% NA
Indica II  465 3.20% 8.20% 0.86% 87.74% NA
Indica III  913 1.20% 15.20% 0.77% 82.80% NA
Indica Intermediate  786 4.10% 18.70% 1.65% 75.57% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 88.50% 0.00% 2.08% 9.38% NA
Intermediate  90 62.20% 6.70% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922495561 A -> G LOC_Os09g39170.1 upstream_gene_variant ; 1241.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922495561 A -> G LOC_Os09g39170-LOC_Os09g39180 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922495561 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922495561 NA 6.54E-06 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561 6.05E-08 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561 2.07E-09 3.64E-12 mr1865 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561 5.92E-06 NA mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561 8.83E-06 3.79E-07 mr1520_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922495561 NA 5.83E-08 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251