\
| Variant ID: vg0922495561 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22495561 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 55. )
ACAATTAAAGTTGGGCACGAAAATTATGGTTGCACTTAAAATGGAACGAAGGGAGCAGCATTAACTATATTTAGTGAGGATGAACTTTATAGATATATAG[A/G]
ATGCCTCGTCGATAGGTTAAATCTACATTCATCTTTGATTTGGATTTTCTTTTTAGTCTAGATAGATACTCACTTCTTCTCATATTGATCATCATATAAG
CTTATATGATGATCAATATGAGAAGAAGTGAGTATCTATCTAGACTAAAAAGAAAATCCAAATCAAAGATGAATGTAGATTTAACCTATCGACGAGGCAT[T/C]
CTATATATCTATAAAGTTCATCCTCACTAAATATAGTTAATGCTGCTCCCTTCGTTCCATTTTAAGTGCAACCATAATTTTCGTGCCCAACTTTAATTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.70% | 11.40% | 1.08% | 50.80% | NA |
| All Indica | 2759 | 3.10% | 18.60% | 1.09% | 77.27% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.00% | 0.60% | NA |
| Aus | 269 | 3.00% | 7.10% | 7.06% | 82.90% | NA |
| Indica I | 595 | 4.50% | 31.60% | 1.01% | 62.86% | NA |
| Indica II | 465 | 3.20% | 8.20% | 0.86% | 87.74% | NA |
| Indica III | 913 | 1.20% | 15.20% | 0.77% | 82.80% | NA |
| Indica Intermediate | 786 | 4.10% | 18.70% | 1.65% | 75.57% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 2.08% | 9.38% | NA |
| Intermediate | 90 | 62.20% | 6.70% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922495561 | A -> G | LOC_Os09g39170.1 | upstream_gene_variant ; 1241.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922495561 | A -> G | LOC_Os09g39170-LOC_Os09g39180 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922495561 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922495561 | NA | 6.54E-06 | mr1378 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922495561 | 6.05E-08 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922495561 | 2.07E-09 | 3.64E-12 | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922495561 | 5.92E-06 | NA | mr1520_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922495561 | 8.83E-06 | 3.79E-07 | mr1520_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922495561 | NA | 5.83E-08 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |