Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922490768:

Variant ID: vg0922490768 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22490768
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, C: 0.32, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

TGGATCACCTCTAACTAGCTCAAACCCTCCCCTCTGATGGGTTCGGCCCTGATAAAAAATGAGTGGTTAGTGATAATCCTACTCACCTTACTCACCTCTA[C/A]
CAACTCGAGGCCCGTTAGAGGAGAATGTCGCCTCTAACGGATCGCAACAAAGTCGCCCGTTGGAGGTGACTGTCACCTCGGACGGCTAGATAGGGATACG

Reverse complement sequence

CGTATCCCTATCTAGCCGTCCGAGGTGACAGTCACCTCCAACGGGCGACTTTGTTGCGATCCGTTAGAGGCGACATTCTCCTCTAACGGGCCTCGAGTTG[G/T]
TAGAGGTGAGTAAGGTGAGTAGGATTATCACTAACCACTCATTTTTTATCAGGGCCGAACCCATCAGAGGGGAGGGTTTGAGCTAGTTAGAGGTGATCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.30%	11.20%	0.83%	50.63%	NA
All Indica	2759	4.00%	18.30%	1.34%	76.37%	NA
All Japonica	1512	99.50%	0.00%	0.07%	0.40%	NA
Aus	269	3.00%	7.10%	0.37%	89.59%	NA
Indica I	595	5.40%	31.60%	2.02%	61.01%	NA
Indica II	465	3.70%	8.20%	1.29%	86.88%	NA
Indica III	913	1.60%	15.10%	0.99%	82.26%	NA
Indica Intermediate	786	6.00%	17.80%	1.27%	74.94%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.00%	0.20%	0.60%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	88.50%	0.00%	0.00%	11.46%	NA
Intermediate	90	62.20%	6.70%	0.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922490768	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922490768	C -> A	LOC_Os09g39160.1	downstream_gene_variant ; 382.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922490768	C -> A	LOC_Os09g39170.1	downstream_gene_variant ; 937.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922490768	C -> A	LOC_Os09g39160-LOC_Os09g39170	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922490768	NA	3.82E-06	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0922490768	3.77E-06	5.63E-07	mr1378	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922490768	NA	8.49E-06	mr1407	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922490768	3.79E-06	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922490768	4.82E-07	9.21E-10	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922490768	NA	2.58E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922490768	NA	8.28E-06	mr1968	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251