\
| Variant ID: vg0922446085 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22446085 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, G: 0.32, others allele: 0.00, population size: 69. )
AAATCGATATAAGTAGAGAAGTAATGCTTCCTGCGACACTGAAGTGAAGGGATTAATTAGTAATTGCTAGCTCGAATCACGCTAAGAGCAAGTTTAATAG[G/T]
ATAGCCAACTACTATCTCCAATTCATCTATAGCCAATCTTATAGCTCATTCATACAATAGTTACATACTACACTATTAATACCTGGTCCCATCTGTCATA
TATGACAGATGGGACCAGGTATTAATAGTGTAGTATGTAACTATTGTATGAATGAGCTATAAGATTGGCTATAGATGAATTGGAGATAGTAGTTGGCTAT[C/A]
CTATTAAACTTGCTCTTAGCGTGATTCGAGCTAGCAATTACTAATTAATCCCTTCACTTCAGTGTCGCAGGAAGCATTACTTCTCTACTTATATCGATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.10% | 14.20% | 1.44% | 46.25% | NA |
| All Indica | 2759 | 4.40% | 17.30% | 2.36% | 75.97% | NA |
| All Japonica | 1512 | 99.50% | 0.20% | 0.00% | 0.26% | NA |
| Aus | 269 | 11.20% | 65.10% | 0.74% | 23.05% | NA |
| Indica I | 595 | 4.90% | 0.80% | 4.20% | 90.08% | NA |
| Indica II | 465 | 3.20% | 17.40% | 3.01% | 76.34% | NA |
| Indica III | 913 | 2.40% | 26.00% | 0.77% | 70.87% | NA |
| Indica Intermediate | 786 | 7.00% | 19.60% | 2.42% | 70.99% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 5.20% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 62.20% | 13.30% | 1.11% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922446085 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922446085 | G -> T | LOC_Os09g39110.1 | downstream_gene_variant ; 4295.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922446085 | G -> T | LOC_Os09g39100.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922446085 | NA | 2.24E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 1.69E-11 | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 4.84E-09 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 1.04E-09 | mr1007 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 9.50E-09 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 3.57E-11 | mr1052 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 5.88E-09 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 2.06E-10 | mr1006_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 1.75E-10 | mr1006_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 3.06E-08 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922446085 | NA | 3.76E-11 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |