\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922446085:

Variant ID: vg0922446085 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22446085
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, G: 0.32, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCGATATAAGTAGAGAAGTAATGCTTCCTGCGACACTGAAGTGAAGGGATTAATTAGTAATTGCTAGCTCGAATCACGCTAAGAGCAAGTTTAATAG[G/T]
ATAGCCAACTACTATCTCCAATTCATCTATAGCCAATCTTATAGCTCATTCATACAATAGTTACATACTACACTATTAATACCTGGTCCCATCTGTCATA

Reverse complement sequence

TATGACAGATGGGACCAGGTATTAATAGTGTAGTATGTAACTATTGTATGAATGAGCTATAAGATTGGCTATAGATGAATTGGAGATAGTAGTTGGCTAT[C/A]
CTATTAAACTTGCTCTTAGCGTGATTCGAGCTAGCAATTACTAATTAATCCCTTCACTTCAGTGTCGCAGGAAGCATTACTTCTCTACTTATATCGATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 14.20% 1.44% 46.25% NA
All Indica  2759 4.40% 17.30% 2.36% 75.97% NA
All Japonica  1512 99.50% 0.20% 0.00% 0.26% NA
Aus  269 11.20% 65.10% 0.74% 23.05% NA
Indica I  595 4.90% 0.80% 4.20% 90.08% NA
Indica II  465 3.20% 17.40% 3.01% 76.34% NA
Indica III  913 2.40% 26.00% 0.77% 70.87% NA
Indica Intermediate  786 7.00% 19.60% 2.42% 70.99% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.00% 0.60% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 5.20% 0.00% 3.12% NA
Intermediate  90 62.20% 13.30% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922446085 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922446085 G -> T LOC_Os09g39110.1 downstream_gene_variant ; 4295.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922446085 G -> T LOC_Os09g39100.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922446085 NA 2.24E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 1.69E-11 mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 4.84E-09 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 1.04E-09 mr1007 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 9.50E-09 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 3.57E-11 mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 5.88E-09 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 2.06E-10 mr1006_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 1.75E-10 mr1006_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 3.06E-08 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922446085 NA 3.76E-11 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251