\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922444221:

Variant ID: vg0922444221 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22444221
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCCACGATTTTTTTTTAATTTTTTTTTGCTGACTAGGATGCCACGTCAGTGAAACCACCCACATATACTGCCAAGGGACCTTCGGTGAACGGTTTGAAT[A/G]
AGTTTAGGGGCAAACGTTTCTGGCTTTGTGGTTGAGGGATCTCAAAAAATCTCGCTGTTTTGTTGAGGGAATTTGTTCCGTTGAAACAACCAAGCCTGGC

Reverse complement sequence

GCCAGGCTTGGTTGTTTCAACGGAACAAATTCCCTCAACAAAACAGCGAGATTTTTTGAGATCCCTCAACCACAAAGCCAGAAACGTTTGCCCCTAAACT[T/C]
ATTCAAACCGTTCACCGAAGGTCCCTTGGCAGTATATGTGGGTGGTTTCACTGACGTGGCATCCTAGTCAGCAAAAAAAAATTAAAAAAAAATCGTGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.10% 12.60% 5.73% 46.51% NA
All Indica  2759 19.40% 0.80% 2.72% 77.06% NA
All Japonica  1512 50.90% 36.80% 11.97% 0.33% NA
Aus  269 82.50% 0.00% 0.37% 17.10% NA
Indica I  595 2.90% 1.20% 2.86% 93.11% NA
Indica II  465 18.70% 1.70% 0.86% 78.71% NA
Indica III  913 27.60% 0.20% 2.63% 69.55% NA
Indica Intermediate  786 22.90% 0.60% 3.82% 72.65% NA
Temperate Japonica  767 18.60% 65.20% 16.04% 0.13% NA
Tropical Japonica  504 90.30% 4.20% 5.16% 0.40% NA
Japonica Intermediate  241 71.40% 14.50% 13.28% 0.83% NA
VI/Aromatic  96 88.50% 5.20% 3.12% 3.12% NA
Intermediate  90 52.20% 15.60% 12.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922444221 A -> G LOC_Os09g39090.1 upstream_gene_variant ; 4796.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922444221 A -> G LOC_Os09g39100.1 downstream_gene_variant ; 1445.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922444221 A -> G LOC_Os09g39090-LOC_Os09g39100 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922444221 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922444221 NA 1.19E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 3.23E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 5.00E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 8.88E-09 mr1530 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 1.01E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 1.70E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 1.85E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 1.06E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221 NA 7.41E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251