Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922444221:

Variant ID: vg0922444221 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22444221
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCCACGATTTTTTTTTAATTTTTTTTTGCTGACTAGGATGCCACGTCAGTGAAACCACCCACATATACTGCCAAGGGACCTTCGGTGAACGGTTTGAAT[A/G]
AGTTTAGGGGCAAACGTTTCTGGCTTTGTGGTTGAGGGATCTCAAAAAATCTCGCTGTTTTGTTGAGGGAATTTGTTCCGTTGAAACAACCAAGCCTGGC

Reverse complement sequence

GCCAGGCTTGGTTGTTTCAACGGAACAAATTCCCTCAACAAAACAGCGAGATTTTTTGAGATCCCTCAACCACAAAGCCAGAAACGTTTGCCCCTAAACT[T/C]
ATTCAAACCGTTCACCGAAGGTCCCTTGGCAGTATATGTGGGTGGTTTCACTGACGTGGCATCCTAGTCAGCAAAAAAAAATTAAAAAAAAATCGTGGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.10%	12.60%	5.73%	46.51%	NA
All Indica	2759	19.40%	0.80%	2.72%	77.06%	NA
All Japonica	1512	50.90%	36.80%	11.97%	0.33%	NA
Aus	269	82.50%	0.00%	0.37%	17.10%	NA
Indica I	595	2.90%	1.20%	2.86%	93.11%	NA
Indica II	465	18.70%	1.70%	0.86%	78.71%	NA
Indica III	913	27.60%	0.20%	2.63%	69.55%	NA
Indica Intermediate	786	22.90%	0.60%	3.82%	72.65%	NA
Temperate Japonica	767	18.60%	65.20%	16.04%	0.13%	NA
Tropical Japonica	504	90.30%	4.20%	5.16%	0.40%	NA
Japonica Intermediate	241	71.40%	14.50%	13.28%	0.83%	NA
VI/Aromatic	96	88.50%	5.20%	3.12%	3.12%	NA
Intermediate	90	52.20%	15.60%	12.22%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922444221	A -> G	LOC_Os09g39090.1	upstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922444221	A -> G	LOC_Os09g39100.1	downstream_gene_variant ; 1445.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922444221	A -> G	LOC_Os09g39090-LOC_Os09g39100	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922444221	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922444221	NA	1.19E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	3.23E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	5.00E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	8.88E-09	mr1530	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	1.01E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	1.70E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	1.85E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	1.06E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922444221	NA	7.41E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251