\
| Variant ID: vg0922444221 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22444221 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCCACGATTTTTTTTTAATTTTTTTTTGCTGACTAGGATGCCACGTCAGTGAAACCACCCACATATACTGCCAAGGGACCTTCGGTGAACGGTTTGAAT[A/G]
AGTTTAGGGGCAAACGTTTCTGGCTTTGTGGTTGAGGGATCTCAAAAAATCTCGCTGTTTTGTTGAGGGAATTTGTTCCGTTGAAACAACCAAGCCTGGC
GCCAGGCTTGGTTGTTTCAACGGAACAAATTCCCTCAACAAAACAGCGAGATTTTTTGAGATCCCTCAACCACAAAGCCAGAAACGTTTGCCCCTAAACT[T/C]
ATTCAAACCGTTCACCGAAGGTCCCTTGGCAGTATATGTGGGTGGTTTCACTGACGTGGCATCCTAGTCAGCAAAAAAAAATTAAAAAAAAATCGTGGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.10% | 12.60% | 5.73% | 46.51% | NA |
| All Indica | 2759 | 19.40% | 0.80% | 2.72% | 77.06% | NA |
| All Japonica | 1512 | 50.90% | 36.80% | 11.97% | 0.33% | NA |
| Aus | 269 | 82.50% | 0.00% | 0.37% | 17.10% | NA |
| Indica I | 595 | 2.90% | 1.20% | 2.86% | 93.11% | NA |
| Indica II | 465 | 18.70% | 1.70% | 0.86% | 78.71% | NA |
| Indica III | 913 | 27.60% | 0.20% | 2.63% | 69.55% | NA |
| Indica Intermediate | 786 | 22.90% | 0.60% | 3.82% | 72.65% | NA |
| Temperate Japonica | 767 | 18.60% | 65.20% | 16.04% | 0.13% | NA |
| Tropical Japonica | 504 | 90.30% | 4.20% | 5.16% | 0.40% | NA |
| Japonica Intermediate | 241 | 71.40% | 14.50% | 13.28% | 0.83% | NA |
| VI/Aromatic | 96 | 88.50% | 5.20% | 3.12% | 3.12% | NA |
| Intermediate | 90 | 52.20% | 15.60% | 12.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922444221 | A -> G | LOC_Os09g39090.1 | upstream_gene_variant ; 4796.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922444221 | A -> G | LOC_Os09g39100.1 | downstream_gene_variant ; 1445.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922444221 | A -> G | LOC_Os09g39090-LOC_Os09g39100 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922444221 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922444221 | NA | 1.19E-10 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 3.23E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 5.00E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 8.88E-09 | mr1530 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 1.01E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 1.70E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 1.85E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 1.06E-10 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922444221 | NA | 7.41E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |