\
| Variant ID: vg0922436617 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22436617 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )
CTCTTAATGGGATACACGCCGTACATGGATATGCCACATAGCCCTTCCTTAGCTGCTATGTCACGCTTCATGCGGATGTAGCCACTCTCTCCCCATCTAG[G/T]
ACCCCACGAGTTCCTAGCAATCCAATAGTTGATGTTGTCCTGTGTCACGCCATACCCAACAGTTGTTACTGCATGGTTTACCGATGTCCCGCACGGTCCA
TGGACCGTGCGGGACATCGGTAAACCATGCAGTAACAACTGTTGGGTATGGCGTGACACAGGACAACATCAACTATTGGATTGCTAGGAACTCGTGGGGT[C/A]
CTAGATGGGGAGAGAGTGGCTACATCCGCATGAAGCGTGACATAGCAGCTAAGGAAGGGCTATGTGGCATATCCATGTACGGCGTGTATCCCATTAAGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.80% | 31.80% | 4.36% | 22.05% | NA |
| All Indica | 2759 | 5.40% | 52.20% | 6.96% | 35.45% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 64.30% | 14.50% | 2.97% | 18.22% | NA |
| Indica I | 595 | 2.90% | 46.60% | 13.28% | 37.31% | NA |
| Indica II | 465 | 4.70% | 59.60% | 7.96% | 27.74% | NA |
| Indica III | 913 | 5.40% | 54.40% | 2.08% | 38.12% | NA |
| Indica Intermediate | 786 | 7.80% | 49.50% | 7.25% | 35.50% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 17.80% | 3.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922436617 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922436617 | G -> T | LOC_Os09g39080.1 | upstream_gene_variant ; 2941.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922436617 | G -> T | LOC_Os09g39090.1 | downstream_gene_variant ; 1442.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922436617 | G -> T | LOC_Os09g39080-LOC_Os09g39090 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922436617 | 6.97E-21 | NA | mr1865 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922436617 | 6.48E-20 | 8.51E-24 | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922436617 | 3.12E-18 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922436617 | 2.13E-16 | 1.40E-23 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922436617 | NA | 2.43E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |