\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922435973:

Variant ID: vg0922435973 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22435973
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGTGTATGGGTCTTGTTGAACTCAAAATAATGGAGCTGTTTGTTCATCCGTTAAGGATTCCCTGTCCTCTTTTTTTAATGCCATCCAAATGTATTGTT[T/C]
TATACAATGCCTATGTTATATATTTTTGTTGTAATTTGTATAAGCTTGAACTTTCATGTTGTGTAGTAACATATGCCATAATGATCTATCTTGTCACTTA

Reverse complement sequence

TAAGTGACAAGATAGATCATTATGGCATATGTTACTACACAACATGAAAGTTCAAGCTTATACAAATTACAACAAAAATATATAACATAGGCATTGTATA[A/G]
AACAATACATTTGGATGGCATTAAAAAAAGAGGACAGGGAATCCTTAACGGATGAACAAACAGCTCCATTATTTTGAGTTCAACAAGACCCATACACGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 38.60% 1.99% 18.77% NA
All Indica  2759 4.00% 63.40% 2.03% 30.55% NA
All Japonica  1512 99.50% 0.30% 0.07% 0.07% NA
Aus  269 57.60% 17.50% 12.27% 12.64% NA
Indica I  595 2.70% 66.90% 1.34% 29.08% NA
Indica II  465 4.70% 73.80% 1.29% 20.22% NA
Indica III  913 1.60% 59.10% 2.85% 36.36% NA
Indica Intermediate  786 7.30% 59.70% 2.04% 31.04% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 66.70% 20.00% 3.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922435973 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922435973 T -> C LOC_Os09g39080.1 upstream_gene_variant ; 2297.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922435973 T -> C LOC_Os09g39090.1 downstream_gene_variant ; 2086.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0922435973 T -> C LOC_Os09g39080-LOC_Os09g39090 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922435973 NA 2.26E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 NA 2.89E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 NA 3.82E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 NA 3.37E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 1.92E-09 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 3.39E-09 1.36E-08 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 NA 8.45E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 NA 5.23E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 NA 5.95E-32 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 2.09E-08 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973 3.74E-06 2.31E-06 mr1865_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251