\
| Variant ID: vg0922435973 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22435973 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 112. )
ATCGTGTATGGGTCTTGTTGAACTCAAAATAATGGAGCTGTTTGTTCATCCGTTAAGGATTCCCTGTCCTCTTTTTTTAATGCCATCCAAATGTATTGTT[T/C]
TATACAATGCCTATGTTATATATTTTTGTTGTAATTTGTATAAGCTTGAACTTTCATGTTGTGTAGTAACATATGCCATAATGATCTATCTTGTCACTTA
TAAGTGACAAGATAGATCATTATGGCATATGTTACTACACAACATGAAAGTTCAAGCTTATACAAATTACAACAAAAATATATAACATAGGCATTGTATA[A/G]
AACAATACATTTGGATGGCATTAAAAAAAGAGGACAGGGAATCCTTAACGGATGAACAAACAGCTCCATTATTTTGAGTTCAACAAGACCCATACACGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.70% | 38.60% | 1.99% | 18.77% | NA |
| All Indica | 2759 | 4.00% | 63.40% | 2.03% | 30.55% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.07% | 0.07% | NA |
| Aus | 269 | 57.60% | 17.50% | 12.27% | 12.64% | NA |
| Indica I | 595 | 2.70% | 66.90% | 1.34% | 29.08% | NA |
| Indica II | 465 | 4.70% | 73.80% | 1.29% | 20.22% | NA |
| Indica III | 913 | 1.60% | 59.10% | 2.85% | 36.36% | NA |
| Indica Intermediate | 786 | 7.30% | 59.70% | 2.04% | 31.04% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 20.00% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922435973 | T -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922435973 | T -> C | LOC_Os09g39080.1 | upstream_gene_variant ; 2297.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922435973 | T -> C | LOC_Os09g39090.1 | downstream_gene_variant ; 2086.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0922435973 | T -> C | LOC_Os09g39080-LOC_Os09g39090 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922435973 | NA | 2.26E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | NA | 2.89E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | NA | 3.82E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | NA | 3.37E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | 1.92E-09 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | 3.39E-09 | 1.36E-08 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | NA | 8.45E-27 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | NA | 5.23E-37 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | NA | 5.95E-32 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | 2.09E-08 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922435973 | 3.74E-06 | 2.31E-06 | mr1865_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |