\
| Variant ID: vg0922425823 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 22425823 |
| Reference Allele: C | Alternative Allele: A,CCAGTAATCAACACG |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 76. )
GACGTACGTGTGCATACTATTACCTTATTTATTTAGTTATGAATAAATTACCTTATTTATTTAGTTACGAAAATATGCTCACAGCTCACTGTGCATATAT[C/A,CCAGTAATCAACACG]
TACTTCTACTACTACTTAAAAAATAAGAGGTGCTTCCATCGTCCGTCAAAAAAACCGGGTGAAAAAAAACCGGAACGAATCCGATTCATCAACGCGGTAA
TTACCGCGTTGATGAATCGGATTCGTTCCGGTTTTTTTTCACCCGGTTTTTTTGACGGACGATGGAAGCACCTCTTATTTTTTAAGTAGTAGTAGAAGTA[G/T,CGTGTTGATTACTGG]
ATATATGCACAGTGAGCTGTGAGCATATTTTCGTAACTAAATAAATAAGGTAATTTATTCATAACTAAATAAATAAGGTAATAGTATGCACACGTACGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.80% | 3.60% | 4.46% | 43.04% | CCAGTAATCAACACG: 0.02% |
| All Indica | 2759 | 18.10% | 5.90% | 7.18% | 68.79% | CCAGTAATCAACACG: 0.04% |
| All Japonica | 1512 | 99.80% | 0.00% | 0.07% | 0.13% | NA |
| Aus | 269 | 54.60% | 3.30% | 2.23% | 39.78% | NA |
| Indica I | 595 | 7.90% | 5.40% | 14.12% | 72.61% | NA |
| Indica II | 465 | 8.40% | 4.90% | 5.59% | 81.08% | NA |
| Indica III | 913 | 28.10% | 6.20% | 3.40% | 62.10% | CCAGTAATCAACACG: 0.11% |
| Indica Intermediate | 786 | 20.00% | 6.40% | 7.25% | 66.41% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 71.10% | 1.10% | 4.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922425823 | C -> CCAGTAATCAACACG | LOC_Os09g39060.1 | upstream_gene_variant ; 3266.0bp to feature; MODIFIER | silent_mutation | Average:47.257; most accessible tissue: Callus, score: 71.806 | N | N | N | N |
| vg0922425823 | C -> CCAGTAATCAACACG | LOC_Os09g39070.1 | downstream_gene_variant ; 1641.0bp to feature; MODIFIER | silent_mutation | Average:47.257; most accessible tissue: Callus, score: 71.806 | N | N | N | N |
| vg0922425823 | C -> CCAGTAATCAACACG | LOC_Os09g39060-LOC_Os09g39070 | intergenic_region ; MODIFIER | silent_mutation | Average:47.257; most accessible tissue: Callus, score: 71.806 | N | N | N | N |
| vg0922425823 | C -> DEL | N | N | silent_mutation | Average:47.257; most accessible tissue: Callus, score: 71.806 | N | N | N | N |
| vg0922425823 | C -> A | LOC_Os09g39060.1 | upstream_gene_variant ; 3265.0bp to feature; MODIFIER | silent_mutation | Average:47.257; most accessible tissue: Callus, score: 71.806 | N | N | N | N |
| vg0922425823 | C -> A | LOC_Os09g39070.1 | downstream_gene_variant ; 1642.0bp to feature; MODIFIER | silent_mutation | Average:47.257; most accessible tissue: Callus, score: 71.806 | N | N | N | N |
| vg0922425823 | C -> A | LOC_Os09g39060-LOC_Os09g39070 | intergenic_region ; MODIFIER | silent_mutation | Average:47.257; most accessible tissue: Callus, score: 71.806 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922425823 | NA | 2.02E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | 3.23E-06 | 1.28E-06 | mr1520 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | NA | 3.73E-12 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | NA | 9.16E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | NA | 2.20E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | 5.49E-23 | 9.07E-83 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | 1.13E-11 | 2.77E-10 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | 1.15E-16 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922425823 | 1.70E-06 | 3.84E-06 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |