\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922422731:

Variant ID: vg0922422731 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 22422731
Reference Allele: TAlternative Allele: A,TTA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TATACCGTACTAGACATCATAAGCATCTCTAAAATATTAGGCCGGCATATCTTGAGATTTATAACGTCACCATAAATGTCTCATCATCGACAGATACATC[T/A,TTA]
TCTATATATCACTATAAGAAAAAATAGCTAATTTGAATCTAGTTAGACATATTTAATTAACCCAACTAGTTAAAGATACGCTCACTTCATTCATGCAAAA

Reverse complement sequence

TTTTGCATGAATGAAGTGAGCGTATCTTTAACTAGTTGGGTTAATTAAATATGTCTAACTAGATTCAAATTAGCTATTTTTTCTTATAGTGATATATAGA[A/T,TAA]
GATGTATCTGTCGATGATGAGACATTTATGGTGACGTTATAAATCTCAAGATATGCCGGCCTAATATTTTAGAGATGCTTATGATGTCTAGTACGGTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.30% 0.13% 0.00% TTA: 0.34%
All Indica  2759 97.90% 1.50% 0.11% 0.00% TTA: 0.54%
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 98.70% 0.20% 0.00% 0.00% TTA: 1.10%
Indica Intermediate  786 95.90% 3.20% 0.25% 0.00% TTA: 0.64%
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 37.80% 57.80% 3.33% 0.00% TTA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922422731 T -> TTA LOC_Os09g39050.1 upstream_gene_variant ; 2639.0bp to feature; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N
vg0922422731 T -> TTA LOC_Os09g39060.1 upstream_gene_variant ; 174.0bp to feature; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N
vg0922422731 T -> TTA LOC_Os09g39070.1 downstream_gene_variant ; 4733.0bp to feature; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N
vg0922422731 T -> TTA LOC_Os09g39060-LOC_Os09g39070 intergenic_region ; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N
vg0922422731 T -> A LOC_Os09g39050.1 upstream_gene_variant ; 2638.0bp to feature; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N
vg0922422731 T -> A LOC_Os09g39060.1 upstream_gene_variant ; 173.0bp to feature; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N
vg0922422731 T -> A LOC_Os09g39070.1 downstream_gene_variant ; 4734.0bp to feature; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N
vg0922422731 T -> A LOC_Os09g39060-LOC_Os09g39070 intergenic_region ; MODIFIER silent_mutation Average:42.059; most accessible tissue: Callus, score: 72.517 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922422731 NA 1.17E-101 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 4.33E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 7.62E-45 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 3.16E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.00E-21 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.53E-17 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 4.06E-47 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 5.56E-52 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 6.12E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 1.15E-27 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 3.38E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.48E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 1.67E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 1.09E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 9.96E-25 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 6.76E-20 4.10E-98 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.49E-39 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.09E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 1.02E-100 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 1.39E-41 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.62E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 7.83E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.99E-39 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 8.19E-52 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 7.04E-75 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.20E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 2.10E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 2.84E-25 1.32E-121 mr1865_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 1.43E-33 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922422731 NA 4.42E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251